ID: 967106410

View in Genome Browser
Species Human (GRCh38)
Location 3:186258168-186258190
Sequence CATTCGACACAAATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967106407_967106410 7 Left 967106407 3:186258138-186258160 CCATCCTTGTGCAAGGATAATCT 0: 1
1: 0
2: 0
3: 10
4: 142
Right 967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG 0: 1
1: 0
2: 4
3: 8
4: 148
967106408_967106410 3 Left 967106408 3:186258142-186258164 CCTTGTGCAAGGATAATCTGACT 0: 1
1: 0
2: 1
3: 8
4: 109
Right 967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG 0: 1
1: 0
2: 4
3: 8
4: 148
967106405_967106410 16 Left 967106405 3:186258129-186258151 CCAAGGGGGCCATCCTTGTGCAA 0: 1
1: 0
2: 1
3: 6
4: 97
Right 967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG 0: 1
1: 0
2: 4
3: 8
4: 148
967106404_967106410 22 Left 967106404 3:186258123-186258145 CCAAGGCCAAGGGGGCCATCCTT 0: 1
1: 0
2: 1
3: 17
4: 218
Right 967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG 0: 1
1: 0
2: 4
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967106410 Original CRISPR CATTCGACACAAATGGAAAA TGG Intronic
911289203 1:96035834-96035856 CATTCAATACAAATGGATTAAGG + Intergenic
914944178 1:152048802-152048824 CATTGGACCTAAATGGTAAAAGG - Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
915850110 1:159312683-159312705 CATTCAACACAAGAGTAAAAAGG - Intergenic
916700090 1:167283257-167283279 CATTTTACAAAAATGTAAAAAGG - Intronic
917871369 1:179244907-179244929 CTTTTGACAGAAATGGAAGAAGG + Intergenic
919550404 1:198978414-198978436 CATAAGAAACAAATGAAAAAGGG + Intergenic
1063356578 10:5405252-5405274 CATAGGACACAGATGTAAAAAGG - Intergenic
1064374744 10:14785269-14785291 CAATAGACATAAATGGAAACTGG + Intergenic
1065353528 10:24816860-24816882 CATTTTACACAAGTGGAAACAGG - Intergenic
1065490469 10:26277157-26277179 CATCGGGCAGAAATGGAAAAGGG + Intronic
1068553914 10:58436473-58436495 CATTCGACTGAAATTTAAAATGG - Intergenic
1070514048 10:77187240-77187262 GATTCAACATAAATGGAAACAGG + Intronic
1073156591 10:101352215-101352237 AATTCTACACAAGTGCAAAATGG - Intergenic
1073745666 10:106465612-106465634 CATTGGACAGACATTGAAAATGG - Intergenic
1074130778 10:110572318-110572340 CAGTCAACATAACTGGAAAATGG - Intronic
1074211392 10:111338525-111338547 CATTTTACACATATGGAAATTGG - Intergenic
1077983686 11:7329510-7329532 CATTTGAGACAAAAGGAAAGTGG + Intronic
1079395039 11:20054943-20054965 CATTAGACACATTTAGAAAAAGG + Intronic
1079880741 11:25923253-25923275 AATACCACTCAAATGGAAAAGGG + Intergenic
1080212343 11:29800882-29800904 CATTCCACACAAATGGGAAAAGG + Intergenic
1082714834 11:56599644-56599666 CATTCTACACAAAAGGACATTGG + Intergenic
1084566922 11:69935127-69935149 CATTTCACTCACATGGAAAAGGG + Intergenic
1085432474 11:76465229-76465251 CAATGCAAACAAATGGAAAATGG - Intronic
1085652765 11:78283312-78283334 CTTTGTGCACAAATGGAAAAAGG - Intronic
1086761729 11:90639614-90639636 CTTTTGATGCAAATGGAAAAGGG - Intergenic
1086843773 11:91721947-91721969 CATACATTACAAATGGAAAATGG - Intergenic
1090590548 11:128262416-128262438 CATTTCCCACAAATGGGAAAGGG - Intergenic
1092590296 12:9947052-9947074 CATTAGTCACAGATGGGAAAGGG - Intergenic
1092730151 12:11523809-11523831 TCTTGGACACACATGGAAAAGGG + Intergenic
1094333435 12:29321608-29321630 CATTCAACAGAAAAAGAAAAGGG - Intronic
1095796089 12:46220232-46220254 CATTTGAAATACATGGAAAAGGG - Intronic
1096483679 12:51961018-51961040 CATTCCAGAGAAAAGGAAAAGGG - Intronic
1097425517 12:59439754-59439776 CCTGCAACACAAATTGAAAAGGG - Intergenic
1097652212 12:62313938-62313960 CATTAGACAAATATGGCAAAAGG - Intronic
1098487261 12:71035803-71035825 CAGTCGATATAAATAGAAAAGGG - Intergenic
1098630212 12:72713533-72713555 GATCAGACACCAATGGAAAATGG + Intergenic
1100930078 12:99598453-99598475 CATTCTACAGATATGGAAACAGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102759243 12:115371088-115371110 CCTTCCACAGAAAAGGAAAAGGG - Intergenic
1103082403 12:118035667-118035689 CAACAGACACAAAAGGAAAAAGG + Intronic
1103744186 12:123111053-123111075 CATTCAAAACAAAATGAAAAAGG + Intronic
1105366763 13:19772408-19772430 CATTGGAAACAACTGGAGAAAGG + Exonic
1106523385 13:30518374-30518396 AATTCAACACAAAGGGAAATAGG - Intronic
1108881171 13:55118389-55118411 TATTCCATACAAATGGAATAAGG - Intergenic
1109130656 13:58580905-58580927 CATTAGAAAAAAATGCAAAAAGG + Intergenic
1109346548 13:61121438-61121460 GATTCTACACAAATAAAAAAAGG + Intergenic
1110001344 13:70206060-70206082 CATTCTACACAGAAGGAAAGTGG - Intergenic
1110671215 13:78180808-78180830 TATTTTACAAAAATGGAAAATGG - Intergenic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1112807418 13:103178519-103178541 CATTGGGCAAAAATGGCAAAAGG - Intergenic
1113347907 13:109498721-109498743 GTTTCGTCACAAATGGCAAAAGG + Intergenic
1113419380 13:110158512-110158534 CATTCAACAGAAAAGGGAAAAGG - Intronic
1115361608 14:32509564-32509586 CATACCACACAAATGGCCAATGG - Intronic
1115438823 14:33408403-33408425 CATGCCATACACATGGAAAAGGG + Intronic
1116616641 14:47148853-47148875 CAATCTACACAAATTAAAAATGG - Intronic
1117096589 14:52304760-52304782 CACTTGACATAATTGGAAAAAGG - Intergenic
1117432502 14:55682308-55682330 CACTCCCCACAAATGGAAAGCGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118682846 14:68261300-68261322 CAATCACCACAAAAGGAAAAGGG - Intronic
1120366650 14:83580066-83580088 CATTCTAAACAAAAAGAAAAAGG + Intergenic
1121414945 14:93773034-93773056 CATTCTACACATTTGGAAATTGG + Intronic
1124217923 15:27825089-27825111 CATTAGACACAATTAAAAAATGG + Intronic
1125576668 15:40760435-40760457 CATTGGTCAAGAATGGAAAAGGG - Intergenic
1127220147 15:56871136-56871158 CATTTAACACAAATGCTAAAGGG + Intronic
1130085759 15:80777718-80777740 CATTTGGCCCAAATGGAGAAAGG - Intergenic
1132160518 15:99537198-99537220 CATTGTACAGAAATTGAAAAAGG + Intergenic
1134198328 16:12176366-12176388 CATTTCACATAAATGGAAACCGG - Intronic
1137389321 16:48068288-48068310 CATTCGAGATGAATGGAAAATGG + Intergenic
1138234777 16:55372907-55372929 CATTGGACACAACAGGCAAAAGG - Intergenic
1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG + Intergenic
1149335640 17:55633095-55633117 CCTTGGACACAAAGGGAAAATGG - Intergenic
1149956258 17:61054107-61054129 CAATGAACACAAATGCAAAAAGG - Intronic
1153705341 18:7739199-7739221 CATTTGAAACAAATTGGAAAGGG - Intronic
1158831708 18:61286785-61286807 TATTTGAAAGAAATGGAAAAAGG - Intergenic
1164911726 19:32018166-32018188 CATTTCTCACAAAAGGAAAAGGG - Intergenic
1167401131 19:49270706-49270728 AATTCGACACAAAGGAAAATGGG + Intergenic
926236624 2:11050301-11050323 CATTTGACACAGAAGGAAACAGG - Intergenic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
932960773 2:76409713-76409735 GATAGGACAGAAATGGAAAATGG - Intergenic
936794470 2:116188885-116188907 GATCAGACACAAATGGAACATGG + Intergenic
936851724 2:116907296-116907318 CATGAGAGACATATGGAAAATGG - Intergenic
938694984 2:133826964-133826986 CTTTGGATACAAATGAAAAAGGG - Intergenic
940035607 2:149309645-149309667 CATTCTTCAGAAAGGGAAAAGGG - Intergenic
940062085 2:149583456-149583478 TATTTGACACAGATGGTAAAGGG + Intronic
941367170 2:164622219-164622241 CATTTTACACAAAAGGAAACTGG + Intergenic
942041867 2:172074030-172074052 CATTCCTCACAAAAGCAAAAGGG - Intronic
942561462 2:177224340-177224362 CGTTTGACACAAAGGGAAAAGGG + Intergenic
943521279 2:188952448-188952470 TATTCAACACAAATTGATAATGG - Intergenic
944037180 2:195309131-195309153 CATAGGACTAAAATGGAAAAGGG - Intergenic
944538679 2:200736483-200736505 TATTTGACACAGAGGGAAAAGGG - Intergenic
945086150 2:206134651-206134673 GATACAAAACAAATGGAAAAAGG + Intronic
945589801 2:211715912-211715934 CATTCGGCAGAAATGTGAAAGGG - Intronic
1169966578 20:11224488-11224510 CTTTCTACCCATATGGAAAAAGG - Intergenic
1172388746 20:34551952-34551974 AATTCAACAAAAAGGGAAAATGG + Intronic
1173835992 20:46126113-46126135 CATTCGTCACAAACGGAGAGGGG + Intronic
1174876854 20:54235920-54235942 CATTTGAAACAAGTGAAAAACGG + Intergenic
1179277797 21:39907939-39907961 CATTGGCAACAACTGGAAAAAGG - Intronic
1180890145 22:19282024-19282046 CATTCTTCAGAAATGGGAAAGGG + Intronic
949221599 3:1640730-1640752 CATTTTACAGAAATGGAAAAAGG + Intergenic
949649878 3:6144760-6144782 CATTTTACAAAAATGGATAATGG + Intergenic
952202047 3:31139860-31139882 GATTCCACACAGATGTAAAAAGG + Intergenic
956199075 3:66687385-66687407 CATTTGAAACAAATGAAAAAAGG + Intergenic
957257838 3:77861763-77861785 CATTGGAAACAAATTGGAAATGG - Intergenic
961527143 3:127512052-127512074 CATTTGAGACAAGTGAAAAATGG + Intergenic
963258806 3:143173474-143173496 GATTAGACACAGCTGGAAAAGGG - Intergenic
964752701 3:160067173-160067195 CATTCGACAGAAATCAAAATTGG - Intergenic
965062406 3:163801877-163801899 GATAGGACAGAAATGGAAAATGG + Intergenic
965443797 3:168749532-168749554 AAATGGACACAAATGTAAAAGGG - Intergenic
965690524 3:171351864-171351886 CATTCAACACAAAAGTTAAATGG + Intronic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG + Intronic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
970635162 4:18001808-18001830 AATTCTACACAAATGGTAACAGG + Intronic
970885244 4:20980538-20980560 AATTAGACACAGATAGAAAAGGG - Intronic
974377989 4:61102459-61102481 AATTCTAAACCAATGGAAAATGG + Intergenic
984544506 4:181085270-181085292 CATTCTACAAAATTGGGAAATGG + Intergenic
984838447 4:184044668-184044690 CAACTGACACAACTGGAAAATGG - Intergenic
987101296 5:14593457-14593479 CATTCGACAAAAATGAGCAAAGG - Intronic
991631787 5:68664041-68664063 CATTGGACACAAATGGTAAATGG + Intergenic
993771516 5:91933635-91933657 CATTTGACAAGAATTGAAAAGGG - Intergenic
994293339 5:98057196-98057218 CATTTTACAAAAATGAAAAATGG + Intergenic
994588617 5:101744663-101744685 GAGACGATACAAATGGAAAAAGG + Intergenic
995815535 5:116163859-116163881 AATTTCACACAAATGGAAACTGG - Intronic
996243627 5:121232749-121232771 CCTGCGTCACAGATGGAAAATGG - Intergenic
1000745140 5:165023554-165023576 CATTCTACCGAAATGGACAAAGG - Intergenic
1000927253 5:167209127-167209149 CATTTGACACATAAGGAAAAAGG - Intergenic
1002615158 5:180448525-180448547 GACTCGATAAAAATGGAAAAGGG - Intergenic
1003003423 6:2358685-2358707 CATTCGTCACAACAGAAAAAAGG - Intergenic
1011312337 6:85993710-85993732 CACTAGACACAGATGCAAAAGGG - Intergenic
1011968503 6:93191504-93191526 CATGAGACAAAAATGAAAAAAGG + Intergenic
1012071063 6:94617149-94617171 CATTCTACATAAATGGAACCAGG + Intergenic
1021175716 7:17447857-17447879 CATACCAAGCAAATGGAAAACGG - Intergenic
1021954099 7:25806687-25806709 CCATCCACACAAAAGGAAAAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024919128 7:54538821-54538843 CATTGTACACATATGGAAAGAGG + Intergenic
1024963495 7:55002771-55002793 TATTGGACACAACTGGAAGAAGG + Intergenic
1025854850 7:65267918-65267940 CATTGGTGACAAAAGGAAAAAGG + Intergenic
1026549757 7:71357956-71357978 GATTGGACAGAAATGGAACATGG + Intronic
1027501890 7:78962332-78962354 ACTTCGTCTCAAATGGAAAAAGG + Intronic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1028615634 7:92763779-92763801 CATATGACACAAGTGGGAAATGG - Intronic
1033866213 7:145692864-145692886 TATTGGGCAAAAATGGAAAAAGG - Intergenic
1036908187 8:12725940-12725962 CAACCGACACAAATGGAAAAAGG + Intronic
1040600848 8:48882744-48882766 CTTTTGACACAAATGAAAAATGG - Intergenic
1040799428 8:51324820-51324842 CACTGGAAACAAATGAAAAATGG - Intronic
1045262626 8:100590105-100590127 CATTGGACTCTAGTGGAAAATGG - Intronic
1046221185 8:111217348-111217370 CAATCCACACAAATTGAAAGTGG + Intergenic
1047525009 8:125625571-125625593 CATTAGACAGAAATGGAATTGGG + Intergenic
1057343503 9:94225675-94225697 GATAGGACAGAAATGGAAAATGG + Intergenic
1059647710 9:116283826-116283848 CACACGGGACAAATGGAAAAGGG - Intronic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1203769826 EBV:43973-43995 TCTTCAGCACAAATGGAAAAGGG - Intergenic
1186842711 X:13500689-13500711 CATTGGAGACAAAGAGAAAAAGG - Intergenic
1187597605 X:20790955-20790977 CTTTTCTCACAAATGGAAAAGGG - Intergenic
1189224392 X:39400476-39400498 TAGTCAACACAAATGGGAAAAGG + Intergenic
1189425882 X:40899515-40899537 CATACCATACATATGGAAAAGGG - Intergenic
1198601965 X:138293958-138293980 CATTAGTGACAAATGGGAAATGG + Intergenic
1198670563 X:139075710-139075732 CATTCTGCACTAATGGCAAATGG - Intronic
1199697966 X:150357156-150357178 CAATAGAAACAAATGGGAAATGG - Intergenic