ID: 967106606

View in Genome Browser
Species Human (GRCh38)
Location 3:186259669-186259691
Sequence CGGGGCTGTCTGCATACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967106606_967106625 25 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106625 3:186259717-186259739 TCTCGAGCACCGGCCCGGACTGG 0: 1
1: 0
2: 0
3: 2
4: 36
967106606_967106618 1 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106618 3:186259693-186259715 GCCCGGGGCCGGCCAGTAGAGGG 0: 1
1: 0
2: 1
3: 10
4: 98
967106606_967106624 20 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106624 3:186259712-186259734 AGGGCTCTCGAGCACCGGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 79
967106606_967106626 26 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106626 3:186259718-186259740 CTCGAGCACCGGCCCGGACTGGG 0: 1
1: 0
2: 0
3: 1
4: 45
967106606_967106627 29 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106627 3:186259721-186259743 GAGCACCGGCCCGGACTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 130
967106606_967106617 0 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106617 3:186259692-186259714 GGCCCGGGGCCGGCCAGTAGAGG 0: 1
1: 0
2: 1
3: 35
4: 185
967106606_967106623 15 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106623 3:186259707-186259729 AGTAGAGGGCTCTCGAGCACCGG 0: 1
1: 0
2: 0
3: 4
4: 76
967106606_967106613 -10 Left 967106606 3:186259669-186259691 CCCAGAGTATGCAGACAGCCCCG 0: 1
1: 0
2: 1
3: 6
4: 110
Right 967106613 3:186259682-186259704 GACAGCCCCGGGCCCGGGGCCGG 0: 1
1: 1
2: 3
3: 68
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967106606 Original CRISPR CGGGGCTGTCTGCATACTCT GGG (reversed) Intronic