ID: 967109328

View in Genome Browser
Species Human (GRCh38)
Location 3:186279730-186279752
Sequence CTGGTCATGGCACGTCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967109328 Original CRISPR CTGGTCATGGCACGTCTGTT GGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
909795331 1:79728516-79728538 CTTGTCATCTCACATCTGTTGGG + Intergenic
911731445 1:101296119-101296141 CAGGTCATGGCAGGTCTTGTAGG + Intergenic
915559033 1:156675888-156675910 GTGGCCATGGCACCTCTGTGTGG + Intronic
915657190 1:157370923-157370945 CTGGTGGAGGCACGTGTGTTGGG - Intergenic
924039585 1:239971320-239971342 CTGTACATGGCACCTCTGCTCGG + Intergenic
1063288140 10:4712494-4712516 CTGGCCATGGCATCTCTGGTGGG + Intergenic
1079369765 11:19841033-19841055 CTTTTCATGGCACCTCTTTTGGG + Intronic
1085784084 11:79436697-79436719 CTGGTCAAGGCCGGTCTATTAGG + Intronic
1089752657 11:120662407-120662429 CGGGTCCTGGCACTGCTGTTTGG - Intronic
1090655393 11:128839726-128839748 ATGGTCTTGGCACGTTTTTTGGG + Exonic
1097976971 12:65696902-65696924 CTGATCATGTCACTGCTGTTTGG - Intergenic
1099973419 12:89523909-89523931 CTGGTTAGGGCCCGTCTGATTGG - Exonic
1110537416 13:76667625-76667647 CTAGTCATGGAAAGTCTGATAGG + Intergenic
1113867764 13:113539199-113539221 CTGGTCCTGGGTCGTCTGCTGGG - Intronic
1114794756 14:25701109-25701131 ATGGTCATGCCACGGCAGTTTGG - Intergenic
1118048874 14:62004670-62004692 CTCTTCATGGCACGTCTTTTTGG - Intronic
1132957188 16:2600612-2600634 CTGGTCATGCCACAGCTGCTGGG + Exonic
1132969531 16:2679024-2679046 CTGGTCATGCCACAGCTGCTGGG + Intergenic
1140983227 16:80130972-80130994 CGGGTAATGGCACCTCTGTTTGG - Intergenic
1145781677 17:27567823-27567845 CTGGTCCTGGCACCATTGTTTGG + Intronic
1147566450 17:41539236-41539258 CTGGTGCTGGCACGGCTGGTAGG - Intergenic
1147603863 17:41762969-41762991 CTGGTCAAGGTACTGCTGTTAGG - Exonic
1159321172 18:66851199-66851221 CTAGTCATGGAGCCTCTGTTGGG + Intergenic
1160142762 18:76339912-76339934 CAGGTCCAGGCACGTCTGTGGGG - Intergenic
1161361996 19:3855682-3855704 CTGGTCATGGCGGGCCTGGTGGG + Intronic
929724193 2:44407049-44407071 GTGGTCATGCCTCTTCTGTTAGG + Intronic
934121835 2:88847676-88847698 CAGGTGAGGGCATGTCTGTTGGG + Intergenic
934514958 2:94980826-94980848 CTGGGCAGGGCAGGTCTGTGGGG + Intergenic
942691190 2:178587139-178587161 CTGGTTTTGGGACATCTGTTGGG + Exonic
944500736 2:200357177-200357199 CTGTTCATTCCACCTCTGTTTGG + Intronic
948170333 2:235896507-235896529 CTGGTCATGGTACATTTGCTGGG + Intronic
1170878318 20:20271833-20271855 CTGGTCATTTCTCATCTGTTAGG + Intronic
1174111452 20:48200797-48200819 CTGGTCATGGCCCTCCTGGTGGG - Intergenic
1180676514 22:17590153-17590175 CTGGTCATAGCACCTCTCTTTGG + Exonic
1180965232 22:19784697-19784719 CGGGTCCTGGCACGTCTGCCTGG - Exonic
1181456334 22:23062090-23062112 CTGGTCATGGCAGGGATGCTGGG + Intronic
1185099370 22:48829478-48829500 CTGGTAATGGAACCTCTGCTGGG + Intronic
950323744 3:12084028-12084050 CTGTTTATGGCATCTCTGTTAGG + Intronic
950573481 3:13816578-13816600 CTGATCATGGCAGATCTGCTAGG + Exonic
967109328 3:186279730-186279752 CTGGTCATGGCACGTCTGTTGGG + Intronic
973786476 4:54337268-54337290 CTGGTCCTGGCACCTCAGGTGGG + Intergenic
988986452 5:36623897-36623919 CTGGTCATGCTACGTCTCCTTGG + Intronic
999104571 5:149059521-149059543 CTGCTGATGGTAGGTCTGTTAGG - Intronic
1001273910 5:170336500-170336522 CAGGTCAAGGCAAGTCTGGTAGG - Intergenic
1004006593 6:11642537-11642559 GTGGTCATGGCACACCTTTTGGG - Intergenic
1006807682 6:36799157-36799179 CTGGGCCTGGCATGGCTGTTTGG - Intronic
1010972260 6:82275479-82275501 CTGCTCATGGTATGTCTCTTGGG - Intergenic
1013945010 6:115712081-115712103 CTGGTCATGAAGCTTCTGTTCGG - Intergenic
1019391938 7:793270-793292 CTGGTCAAGTCAGGGCTGTTGGG - Intergenic
1021183992 7:17541671-17541693 TTGGTCATGACAGCTCTGTTTGG - Intergenic
1035445742 7:158941915-158941937 CTGGTCATAGGCCGGCTGTTCGG + Exonic
1041706452 8:60851346-60851368 CTGCTCAGTGCACGTCTGCTCGG - Intronic
1042544548 8:69939576-69939598 CTAGTCATTGGACCTCTGTTAGG - Intergenic
1045237457 8:100365989-100366011 CTGGTCTTGGCACTGCTGTTTGG + Intronic
1050698328 9:8304953-8304975 CTGTTCTTGGTACTTCTGTTTGG - Intergenic
1051379130 9:16437028-16437050 CTGGTCAGGGCATTTCTATTGGG + Exonic
1056934612 9:90906483-90906505 CTGGACATGTGACATCTGTTGGG - Intergenic
1057500079 9:95589914-95589936 CAGGTCATGGCACGCTTGTGGGG + Intergenic
1058731103 9:107850685-107850707 CTGGTCATGGCCGCTCTGTGGGG + Intergenic
1059220997 9:112618531-112618553 CTGGACAGGGCAGGTCTGTGGGG - Intronic
1060472005 9:123955975-123955997 CTACTCATGGCCCGTCTGTTGGG + Intergenic
1190257418 X:48773921-48773943 CTGGTCCTGGAAGGTCTGATGGG - Intergenic