ID: 967110694

View in Genome Browser
Species Human (GRCh38)
Location 3:186290934-186290956
Sequence ATGCCTATTCCCACCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967110690_967110694 -2 Left 967110690 3:186290913-186290935 CCCTGGAGAGAACCAGGAGTAAT 0: 1
1: 0
2: 0
3: 18
4: 231
Right 967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG 0: 1
1: 0
2: 0
3: 10
4: 120
967110691_967110694 -3 Left 967110691 3:186290914-186290936 CCTGGAGAGAACCAGGAGTAATG 0: 1
1: 0
2: 1
3: 22
4: 145
Right 967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967110694 Original CRISPR ATGCCTATTCCCACCAACCA GGG Intronic
900033356 1:387185-387207 ATGCCTATGCCCAGTATCCAGGG + Intergenic
900054194 1:617074-617096 ATGCCTATGCCCAGTATCCAGGG + Intergenic
900107999 1:993642-993664 CTGCCGATCCCCCCCAACCATGG - Intergenic
900805860 1:4767992-4768014 ACCCCTAATCCCACCAACAATGG - Intronic
903886252 1:26542705-26542727 ATGGCTATGCCCACCCACAATGG - Intronic
904153589 1:28463855-28463877 ATGCCTAGTCCCAGCTACCTGGG - Intronic
904639558 1:31914324-31914346 ATGCCTGTTCCCACCACTCTGGG - Intronic
905675148 1:39819509-39819531 AGGCGTCTTCCCACCAACAAAGG - Intergenic
913228319 1:116720110-116720132 CTGCCTTTTTTCACCAACCAGGG - Intergenic
913587198 1:120287237-120287259 ATGCCTTTTCCCACCAGGCGCGG - Intergenic
913620987 1:120611132-120611154 ATGCCTTTTCCCACCAGGCGCGG + Intergenic
914603613 1:149231136-149231158 ATGCCTTTTCCCACCAGGCGCGG + Intergenic
916676426 1:167067482-167067504 ATCCCTCTTCCTCCCAACCAGGG - Intronic
924336914 1:242994204-242994226 ATGCCTATGCCCAGTATCCAGGG + Intergenic
1063666468 10:8063619-8063641 TTGCCTTTTGCCACCATCCAGGG + Intronic
1063777728 10:9283366-9283388 ATGCCTATTCCCACCACCTGTGG + Intergenic
1065215862 10:23447729-23447751 ATGCCTAATCCCAGCAACTCAGG - Intergenic
1069441462 10:68432668-68432690 CTGCCTTTTCCCACCAATCCAGG - Intronic
1081235605 11:40643680-40643702 ATTCCTATTCCTCCCAGCCAGGG + Intronic
1082188632 11:49215089-49215111 ATGCATATTCCAACCATCTAGGG + Intergenic
1086647595 11:89244000-89244022 ATGCATAATTCTACCAACCAGGG - Intronic
1086677891 11:89631596-89631618 ATGCATATTCCAACCATCTAGGG - Intergenic
1089138520 11:116268326-116268348 GTGCCCATTCCCACCTACCAGGG - Intergenic
1094120912 12:26973298-26973320 ATGCCTACTCCCAGCTCCCAAGG - Exonic
1094312594 12:29100905-29100927 ATCCCTCTTCCCCCCAACAAAGG - Intergenic
1096424613 12:51490602-51490624 ATGCCATGTCCCACCATCCATGG - Intronic
1097071003 12:56354862-56354884 ACTCCTGTTCCCACCATCCAGGG - Exonic
1098270218 12:68762758-68762780 ATGACTATTGCCAACAACCTTGG + Intronic
1100721248 12:97361029-97361051 CTGCCCATTTCTACCAACCATGG - Intergenic
1102537784 12:113594037-113594059 ATGCATATTCTCACCAGGCAGGG - Intergenic
1102929579 12:116851974-116851996 ATGGATGTTTCCACCAACCAGGG + Intronic
1103719581 12:122966174-122966196 ATGCCTATTCCCACCGAGGCAGG + Intronic
1104039621 12:125121376-125121398 ATGCCTCTTGCCACAAAACAGGG - Intronic
1110857840 13:80316158-80316180 ATGCCTATTCCTAATAACTATGG - Intergenic
1115307418 14:31946725-31946747 ATGCCTTACCCCACCAACCAGGG - Intronic
1116110710 14:40576966-40576988 ATGCCAATAGCCTCCAACCAGGG + Intergenic
1118173673 14:63414828-63414850 ATAACGATTCCCACAAACCAAGG + Intronic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118348610 14:64957850-64957872 ATGCCTTTTCCCACACACCCTGG + Intronic
1120594080 14:86412792-86412814 ATGCCTATCACCACCACTCATGG - Intergenic
1125127837 15:36245140-36245162 ATTTACATTCCCACCAACCATGG - Intergenic
1129149285 15:73677607-73677629 ATGCCCCTTCCCGCCAGCCAGGG + Intergenic
1135856420 16:26015305-26015327 ATACGTATTACAACCAACCAAGG + Intronic
1137563782 16:49520731-49520753 TTGCCTGTTCCACCCAACCAGGG + Intronic
1137827411 16:51511209-51511231 ATGCCAATGCACACCAACCTGGG + Intergenic
1146902612 17:36598423-36598445 CTGCCCATTCCAGCCAACCAGGG - Intronic
1149182890 17:53961451-53961473 ATTCCTAATCCCAACATCCAGGG - Intergenic
1154951097 18:21210544-21210566 CTTCCTATTCCCAACAGCCAAGG - Intergenic
1155270198 18:24133982-24134004 ATGACTATTCCCTCAAAACAAGG - Intronic
1156472603 18:37387207-37387229 CTGCCTTTTCCCGGCAACCAGGG + Intronic
1158225225 18:55194122-55194144 ATCCCTCTACCCACCTACCATGG + Intergenic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1160900315 19:1424623-1424645 TTGCCTGTTCCCACCCCCCACGG + Intronic
1161106589 19:2446612-2446634 ATGCCACTTCGCACCAGCCAGGG + Intronic
1165709583 19:38000581-38000603 AAGCCTATTTCCTCAAACCATGG - Intronic
1166571138 19:43798034-43798056 ATGCCTCTTCCCTCAGACCAGGG + Intronic
930471069 2:51814337-51814359 ATGATTATTCCCAGCAGCCATGG - Intergenic
931567214 2:63627511-63627533 TTGCCTTTTCCAACCACCCATGG + Intronic
932242723 2:70170287-70170309 ATGCCACTTCACCCCAACCAGGG - Intronic
932340993 2:70962597-70962619 CTGCCTACTCCCAGGAACCATGG + Intronic
936061197 2:109296765-109296787 CTGCCTATTCCCACACGCCATGG - Intronic
936084258 2:109455856-109455878 CTGCATGCTCCCACCAACCAGGG + Intronic
943284076 2:185974621-185974643 ATGCCTGTTCACACTAATCAAGG - Intergenic
943466146 2:188231304-188231326 GGGCCTATTCCCAACAAACAAGG + Intergenic
946114918 2:217452968-217452990 ATGCCCAGTCCCAGCAACCGGGG + Intronic
947461336 2:230306824-230306846 CTGCCTTTCCCCACCACCCATGG - Intronic
1172218790 20:33257532-33257554 AGGCCTCTGCCCAGCAACCATGG + Intergenic
1174279029 20:49425004-49425026 GTGCTCATTCCCACCAGCCAGGG - Intronic
1175880681 20:62256965-62256987 ATGCCCCTTCCCACCAGCAATGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178895172 21:36551615-36551637 ATCCCTCTACCCACCACCCAAGG - Intronic
1181894217 22:26092829-26092851 ATGCCTACTCCCTCCCTCCATGG - Intergenic
1181961147 22:26622627-26622649 ATGCCTCTTCCTACCTTCCAGGG - Exonic
1182770393 22:32791498-32791520 ATGCCTGTACCCGCCAATCAAGG - Intronic
1183083359 22:35471512-35471534 ATGCCTCTTCCCACCAGTCCTGG + Intergenic
1184829653 22:46976399-46976421 ATGTCAGTTCCCACCATCCAGGG + Intronic
1184865858 22:47201629-47201651 CTGCCTCTTGCCACCATCCATGG + Intergenic
951753963 3:26068575-26068597 ATGCAAATTCCCAACACCCAGGG - Intergenic
953389391 3:42525777-42525799 AGCCCTACTCCCACCAACCCTGG - Intronic
953918287 3:46934715-46934737 AGGCCTATTCCCAAGAAACAGGG + Intronic
954706714 3:52484873-52484895 CTGCCTGTTCCCATCAACCAAGG - Intronic
955191264 3:56763668-56763690 ATCCGTAGTCCCACCATCCAGGG - Intronic
962406952 3:135108787-135108809 ATGCCTCTTCCCTCAAACCTAGG + Intronic
965643443 3:170855617-170855639 ATAAATATCCCCACCAACCAAGG - Intronic
967110694 3:186290934-186290956 ATGCCTATTCCCACCAACCAGGG + Intronic
969358245 4:6644155-6644177 ATGCCTGGTCCCAGCTACCAGGG - Intergenic
975274841 4:72484682-72484704 CTGCCTATCCTCACCATCCATGG - Intronic
979240210 4:118441100-118441122 ATGCCTATGCCCAGTATCCAGGG - Intergenic
979673739 4:123388205-123388227 ATCCCTATTCCCATCAACTGAGG + Intergenic
988786602 5:34570956-34570978 ATGGCCAAGCCCACCAACCAGGG + Intergenic
991059425 5:62357124-62357146 ATGCCTCTGCCCACCAGCCTGGG - Intronic
992149722 5:73891134-73891156 AGACCCATTCCCACCCACCAAGG + Intronic
994947966 5:106420981-106421003 ATACACATTCCCACCAACAATGG + Intergenic
1002740464 5:181431683-181431705 ATGCCTATGCCCAGTATCCAGGG - Intergenic
1005997703 6:30941357-30941379 GTGCCTACCCCCACCATCCAGGG - Intronic
1007751931 6:44076253-44076275 AGGCCTGTTCCCACCACCCCAGG - Intergenic
1011068325 6:83354167-83354189 ATGCCAATGCCCTCCAACCTGGG - Intronic
1012070067 6:94603499-94603521 GTGCCTATTCCCACCAGGCAGGG + Intergenic
1015123311 6:129724479-129724501 ATGCATGTTCCTACCTACCAGGG + Intergenic
1017510573 6:155111154-155111176 ATGCCTTTTTCCACCTTCCAGGG - Intronic
1018289507 6:162277174-162277196 ATCCCGATTCCCACCAATCTTGG - Intronic
1019245575 6:170707287-170707309 ATGCCTATGCCCAGTATCCAGGG - Intergenic
1021958675 7:25852127-25852149 ATGGCTAATCTCACCAACCCTGG + Intergenic
1022474975 7:30704040-30704062 ATTCCTGTACCAACCAACCATGG - Intronic
1023513012 7:40973107-40973129 ATTCCTGTTTCCACCAACCTGGG - Intergenic
1026223602 7:68421766-68421788 TTGCCTCTTCCCTCCAACCCAGG - Intergenic
1028212034 7:88085452-88085474 ATGCCTGTTTGCACCTACCAAGG + Intronic
1029580487 7:101433823-101433845 CTGACTCTTCCCACCAACCCAGG + Intronic
1032831163 7:135627953-135627975 ATGCTTATTTCAACCAAACAAGG - Exonic
1033819994 7:145123820-145123842 CTGGCTATTACCACCACCCAAGG - Intergenic
1034501372 7:151453016-151453038 TTGGCTAGTCCCAGCAACCAGGG + Intergenic
1034890686 7:154836253-154836275 ATGCATATTTCCCCCAGCCAGGG - Intronic
1035502550 8:100918-100940 ATGCCTATGCCCAGTATCCAGGG + Intergenic
1037768805 8:21787377-21787399 CCGCCTCTTCCCACCAGCCACGG + Intronic
1040661808 8:49583122-49583144 CTGCCTCTTGCCACCATCCATGG - Intergenic
1043935640 8:86138874-86138896 CCGCATATTCCCACCAGCCAAGG + Intronic
1045338898 8:101234007-101234029 ATGACTATTCCCACCATCTTAGG - Intergenic
1057972711 9:99572863-99572885 ATCCCTGTTCCCAGCAACCTGGG + Intergenic
1058124167 9:101172499-101172521 CTTTCTCTTCCCACCAACCAAGG - Intronic
1060526134 9:124322335-124322357 CTGCCTCATCCCACCACCCAGGG + Intronic
1061887144 9:133596888-133596910 GTTCCTCTTCCCACCAATCAGGG + Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1203605773 Un_KI270748v1:56491-56513 ATGCCTATGCCCAGTATCCAGGG - Intergenic
1195287760 X:103401833-103401855 AGTCCTATTTCCACCAACAAGGG - Intergenic
1197890963 X:131269912-131269934 TTGCCAATTCCCCCCAACCCAGG - Intergenic
1202387948 Y:24342929-24342951 ATGCCTATGCCCAGTATCCAGGG - Intergenic
1202482839 Y:25327199-25327221 ATGCCTATGCCCAGTATCCAGGG + Intergenic