ID: 967113717

View in Genome Browser
Species Human (GRCh38)
Location 3:186318174-186318196
Sequence TGTGGGCAAAATTTAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967113717_967113718 -8 Left 967113717 3:186318174-186318196 CCTGGCTCTAAATTTTGCCCACA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 967113718 3:186318189-186318211 TGCCCACACTTTGACACACAAGG 0: 1
1: 0
2: 1
3: 31
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967113717 Original CRISPR TGTGGGCAAAATTTAGAGCC AGG (reversed) Intronic
900754981 1:4427687-4427709 TCTGGGCCAAATTCAGAGGCAGG + Intergenic
901610528 1:10494507-10494529 TCTGGCCAAAATTTAGAGAAAGG - Intronic
902514247 1:16981195-16981217 TGAGGCCAAAATTTCGAGGCCGG - Intergenic
902704229 1:18193298-18193320 TGTGGGCCAAATTCAGAATCTGG + Intronic
904943499 1:34181890-34181912 TTTGGGCAAAATGGAGAGCAAGG + Intronic
905847321 1:41243164-41243186 TGTGGGCATCATTTAGAACATGG + Intergenic
915903906 1:159864373-159864395 TGTGGGCTAATGTTAGAGCTGGG + Intronic
916000173 1:160607794-160607816 TGTGGACAAAATCTAGAGCAGGG - Intergenic
916006305 1:160664344-160664366 TAGGGGCAAAATTGAGAGCAAGG + Intergenic
917393117 1:174560995-174561017 TGTAAATAAAATTTAGAGCCAGG + Intronic
917466212 1:175278731-175278753 AGTGGGCATAATTGAGAGCAAGG - Intergenic
919282885 1:195514683-195514705 TGTTGGCAAAATTCACAGCCTGG + Intergenic
1071244816 10:83751249-83751271 TGTTGGGAAAATTTCCAGCCTGG + Intergenic
1073582857 10:104683592-104683614 TGTGGGTAATTTTTAGTGCCAGG + Intronic
1074825841 10:117215461-117215483 TGTGGTCAGAATTGAGAACCAGG + Intergenic
1076198931 10:128542404-128542426 TCTGGGCAAGATTCAGAGCCAGG + Intergenic
1076566390 10:131402457-131402479 TGTGAGCGACATTTAGAGCTAGG - Intergenic
1078838578 11:15056142-15056164 CGTGGGCAACAGTTAAAGCCAGG + Intronic
1080285148 11:30602367-30602389 AGATGGCAAACTTTAGAGCCAGG - Intergenic
1081327045 11:41757595-41757617 TGTGGGTGACCTTTAGAGCCTGG - Intergenic
1082929505 11:58586144-58586166 TGTGGAGAAAATATAGAGACAGG + Intronic
1083846482 11:65337153-65337175 TCTAGGCAAAATCTAGAGGCAGG + Intronic
1083853039 11:65378928-65378950 TGCAGGCAAAGTGTAGAGCCAGG + Intronic
1086156022 11:83666812-83666834 AGGGGGCAAAATTCAAAGCCTGG + Intronic
1087174447 11:95083120-95083142 GGTGGCCAAAATTTGGACCCAGG + Intergenic
1089068768 11:115682414-115682436 TGTGGGTAAAATGTAGAGTTTGG + Intergenic
1089134636 11:116239322-116239344 TGTGGGCAACATTGGGAGACTGG - Intergenic
1089818804 11:121202202-121202224 TGGGATCAAAATTTAGAGGCTGG + Intergenic
1093772491 12:23033787-23033809 TGTGCGCAAATTTTAAAGACCGG + Intergenic
1096065335 12:48735137-48735159 TGTTGGCAGAATTTAGCTCCTGG - Intergenic
1099659951 12:85544853-85544875 TGTGGGCAACTTCTAAAGCCTGG + Intergenic
1101759611 12:107648013-107648035 TGTGGGCAAAATCTACGGACTGG - Intronic
1105374881 13:19834581-19834603 TCTGACCAAAATTTGGAGCCAGG - Intronic
1107864415 13:44689614-44689636 AGTTGGCAAAATGTAGAGCTTGG + Intergenic
1112363466 13:98738218-98738240 AGTTGGGAAAATTTATAGCCTGG + Intronic
1113242273 13:108351145-108351167 TGTGGTAAATATTTAGTGCCAGG + Intergenic
1117363451 14:55000943-55000965 TGTGGGCAATATTTAGCTGCAGG - Exonic
1117736648 14:58774907-58774929 TGTGGGCCAAATGAAGAGCATGG + Intergenic
1119504497 14:75160648-75160670 TATGGGCAAATTTTATAGCTTGG - Intronic
1120450097 14:84655755-84655777 TGTGGGGAAAATGTAGAATCTGG + Intergenic
1120642327 14:87030058-87030080 TGGGGCCAGAATTTAAAGCCAGG + Intergenic
1125920222 15:43521020-43521042 AGTGGGCAAAGTTTAGAGCCTGG + Exonic
1128743669 15:70099242-70099264 TGAGGGGAAAATATAGATCCGGG - Intergenic
1131825987 15:96322829-96322851 TGCGGGCGAGAATTAGAGCCTGG - Intergenic
1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG + Intergenic
1139208728 16:65055198-65055220 TGTGGGGTAATTTTAGAGACTGG - Intronic
1142020225 16:87777674-87777696 TGTGGCCAAAATCCAGAGCATGG + Intergenic
1142810029 17:2391509-2391531 TGTGGGTTAAAGTTAGACCCTGG - Intronic
1143812535 17:9483897-9483919 TTTAGGCAAAAATAAGAGCCTGG + Intronic
1147643805 17:42021619-42021641 TGTGGGCAAAACTTCAATCCTGG + Exonic
1148326077 17:46784215-46784237 TATGGCCAAAGTTTTGAGCCAGG + Intronic
1149321859 17:55489746-55489768 GATGTGCAAAATTTACAGCCTGG - Intergenic
1153337124 18:3936321-3936343 TGGGGGCAAATTGTAGAGCAAGG - Intronic
1153803682 18:8693794-8693816 TGTGGGCAATATTTAAAGGAGGG + Intergenic
1155338922 18:24794353-24794375 TGTGTGCATAAATTAGAGCATGG + Intergenic
1156090128 18:33456980-33457002 TTTGAGCAAAATTGAGATCCGGG + Intergenic
1162188586 19:8926961-8926983 GGTGGTCAAAATTTAGAGAGTGG + Intronic
925468906 2:4137760-4137782 TGTGTGCAAAAATTAGAGCAGGG - Intergenic
925827806 2:7867143-7867165 TGTGGACAAGGGTTAGAGCCAGG - Intergenic
927009400 2:18887094-18887116 TGTGGGCAAAAACAAAAGCCAGG + Intergenic
929446903 2:42009093-42009115 TGTGGGAAAAACTTGAAGCCTGG + Intergenic
929496417 2:42448316-42448338 AGTGGGCAGGATTTAGACCCCGG - Intronic
930704528 2:54491068-54491090 GTTGGGCAAAATTCAGAGCAGGG + Intronic
934670185 2:96207652-96207674 TCGTGGCAAAATTGAGAGCCTGG - Intronic
935869823 2:107434966-107434988 TGAGGGAAATATTTAGAGTCAGG - Intergenic
936944350 2:117917192-117917214 TGAGGGCACAGGTTAGAGCCAGG + Exonic
937965258 2:127502273-127502295 TGGGGACAAAATTTAGAGTTCGG - Intronic
939528419 2:143325924-143325946 TGTGGGCAATATTTAGGGAAAGG - Intronic
945920712 2:215752203-215752225 TGTTGTCAAAAGTTACAGCCTGG - Intergenic
1172962939 20:38811300-38811322 TGGGGGCAAAGTTTGGGGCCAGG + Intronic
1174847274 20:53954791-53954813 TGGGGAGAAAATTTAGAGCAGGG + Intronic
1181378795 22:22482635-22482657 TGTGGTCAAGAGTTCGAGCCTGG - Intergenic
949599137 3:5579516-5579538 TGTCTGCAAAATGTAGAACCAGG - Intergenic
951100297 3:18680007-18680029 TGATGGCAAAATTTAAAGACAGG - Intergenic
959551941 3:107669848-107669870 AGTGGTCAAAATTCATAGCCAGG + Intronic
960176044 3:114518789-114518811 TGGGGGCAAAAATTAGCCCCAGG - Intronic
960546544 3:118921137-118921159 TGTGGGGAAAAATTAGATCAGGG - Intronic
960853872 3:122083353-122083375 TGTGGCCAAAATGAAGAGACAGG - Intronic
963515988 3:146308658-146308680 TGGGTGCAGAATTTAAAGCCCGG - Intergenic
964278668 3:155037431-155037453 TGGGGGCAAGATTCAAAGCCAGG + Intronic
967113717 3:186318174-186318196 TGTGGGCAAAATTTAGAGCCAGG - Intronic
967221178 3:187249351-187249373 TGAGGTCAAGAATTAGAGCCTGG - Intronic
967452240 3:189638568-189638590 TGAAGGCCAAATTTAGATCCAGG + Intronic
968547087 4:1204940-1204962 TGTGCACAAAATTCAGAGTCAGG - Intronic
970091875 4:12418596-12418618 AGTGGGGAAATTTTAGAGCCAGG + Intergenic
970820980 4:20213476-20213498 TGGGGGCAACATTTAGAGAGTGG - Intergenic
975934594 4:79563017-79563039 TGTTTGCAAAATTTAAAGCATGG - Intergenic
976272071 4:83240624-83240646 TGAGGGCTATATTTTGAGCCAGG - Intergenic
976510879 4:85908743-85908765 TTTGGTCAAAATACAGAGCCAGG + Intronic
979860978 4:125693374-125693396 TGAGGGCCAGATTTGGAGCCAGG + Intergenic
980277818 4:130677942-130677964 GGTGGGCAAAAACTATAGCCAGG - Intergenic
980992706 4:139751770-139751792 TGTGGGCAAAATTGTGACCTGGG - Intronic
982716493 4:158814258-158814280 TGAGCACAGAATTTAGAGCCAGG + Intronic
984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG + Intergenic
985045691 4:185938447-185938469 TGTGGACAAGTTTTAGAGCATGG - Intronic
987897467 5:23965940-23965962 TGTTGGCAAAATTCAGTTCCTGG - Intronic
989011495 5:36877047-36877069 TGCGGGGAACATGTAGAGCCGGG - Exonic
989032598 5:37135087-37135109 TGTGAGGAAAATTTAGAGGCTGG - Intronic
989987109 5:50713885-50713907 TGTGGGCAGATTCTAGAACCTGG + Intronic
990740366 5:58906404-58906426 TGTTGGCAGAATTTAGCTCCTGG - Intergenic
992688046 5:79217074-79217096 TGTGGGGAACATCTAGGGCCCGG + Intronic
994975154 5:106794133-106794155 TGAGGGCAAAATTTAAAACATGG + Intergenic
999675067 5:153991341-153991363 TGAGGGCAAAGTTTAGAAACTGG - Exonic
1000678210 5:164149761-164149783 TGTGCACAAAATTTAGTGCCAGG + Intergenic
1001531366 5:172464398-172464420 GGTGGGCACAATTTAGAACTAGG - Intergenic
1002874940 6:1202424-1202446 TGTGGGCTTAATTTGCAGCCAGG + Intergenic
1004888294 6:20072681-20072703 TGTGGGCAGCCTTTAGAGGCTGG - Intergenic
1004903745 6:20217299-20217321 TCTGGGCATAGTTTAGAGCAAGG - Intergenic
1004999290 6:21224604-21224626 TGTAGGCAAATTGTAGAACCTGG + Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008030708 6:46689949-46689971 TTTGGGAAAAACTTGGAGCCAGG + Exonic
1010788800 6:80038529-80038551 TATAGGCACAATTTAGAGACAGG - Intronic
1013294124 6:108743545-108743567 TGGGGGCAAGATTTGCAGCCTGG + Intergenic
1018330737 6:162725328-162725350 TGTGACAAAAATTCAGAGCCAGG - Intronic
1020470499 7:8529017-8529039 TGTTGGCAGAATTTAGCTCCTGG + Intronic
1020709023 7:11582626-11582648 TATGGGCAAAATTTAGACAAAGG - Intronic
1021344850 7:19513797-19513819 TGCAGGCAACATTTAGAGGCTGG - Intergenic
1023650274 7:42362135-42362157 TGGGGTGAGAATTTAGAGCCAGG - Intergenic
1030401192 7:109052510-109052532 TGTGGGCAAACTCTAAAACCAGG - Intergenic
1031539726 7:122978599-122978621 TGGAGGCAAATTTTAGAGCAGGG - Intergenic
1035024898 7:155818886-155818908 AATGTGCAAAATTAAGAGCCAGG + Intergenic
1037906968 8:22721281-22721303 TGAGGTCAAAATTGAGACCCAGG + Intronic
1038095824 8:24308699-24308721 TTTGGGGGAAATTTATAGCCTGG + Intronic
1039016782 8:33158209-33158231 TGTGGGCAGACTTTAGAAGCTGG - Intergenic
1039502607 8:38029910-38029932 TGGGAGCTAAATTTAGAGCTGGG - Intergenic
1043478756 8:80631489-80631511 TGTGGGCAGAAGTCAGAGCCTGG + Exonic
1043637825 8:82408767-82408789 TGTAGGCAAAATTTATAGTGAGG - Intergenic
1043940607 8:86191534-86191556 TGTGTGCAAAATTTACAACAGGG + Intergenic
1045175822 8:99723799-99723821 TGTGGGCAAAATTCAAAGACAGG + Intronic
1047875183 8:129128582-129128604 TGTGGGCAGAATGTAGAAGCTGG + Intergenic
1049363902 8:142227226-142227248 TGTGGGCAGGATGTAGGGCCTGG - Intronic
1050777147 9:9278548-9278570 TTTGGGAAAAGTTAAGAGCCTGG + Intronic
1051089639 9:13391276-13391298 AGTGTGCAAAAATTACAGCCAGG + Intergenic
1052295580 9:26893389-26893411 TGAGGGAAAAAGGTAGAGCCTGG + Intergenic
1061803838 9:133127459-133127481 TGTGATCTATATTTAGAGCCTGG + Intronic
1187542927 X:20216220-20216242 TGTGGGCAAAATTTTCAGGATGG + Intronic
1190451487 X:50585605-50585627 TGGAGGCAAAATTTGGAGCATGG + Intergenic
1190714939 X:53095064-53095086 TGTGGGTAAAAAATGGAGCCTGG + Intergenic
1191682616 X:63856714-63856736 TGTGGGCAGAATTTTCAGCAGGG + Intergenic
1192211222 X:69129097-69129119 TGAGGGCAAGATCTGGAGCCTGG + Intergenic
1197629390 X:128841010-128841032 TGGGGCAAAAATATAGAGCCTGG - Intergenic
1200926547 Y:8659831-8659853 TGTGGGCAAACTCAAGAGCCTGG - Intergenic
1201428490 Y:13881190-13881212 TGCAGGCCAAATTTAGACCCTGG - Intergenic
1201892664 Y:18959442-18959464 TGTGGTCAAATTTTACAGCTGGG - Intergenic