ID: 967114309

View in Genome Browser
Species Human (GRCh38)
Location 3:186322837-186322859
Sequence TGGGCATAACCCGAGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967114309_967114315 3 Left 967114309 3:186322837-186322859 CCCAGCCGCTCGGGTTATGCCCA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 967114315 3:186322863-186322885 GAAGCCAGTGCCCAGGTCAGAGG 0: 1
1: 1
2: 4
3: 32
4: 363
967114309_967114313 -4 Left 967114309 3:186322837-186322859 CCCAGCCGCTCGGGTTATGCCCA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 967114313 3:186322856-186322878 CCCAAGAGAAGCCAGTGCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 281
967114309_967114318 10 Left 967114309 3:186322837-186322859 CCCAGCCGCTCGGGTTATGCCCA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 967114318 3:186322870-186322892 GTGCCCAGGTCAGAGGCAGGAGG 0: 1
1: 1
2: 2
3: 38
4: 507
967114309_967114317 7 Left 967114309 3:186322837-186322859 CCCAGCCGCTCGGGTTATGCCCA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 967114317 3:186322867-186322889 CCAGTGCCCAGGTCAGAGGCAGG 0: 1
1: 0
2: 5
3: 85
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967114309 Original CRISPR TGGGCATAACCCGAGCGGCT GGG (reversed) Intronic
1070850678 10:79559587-79559609 TGGGCAGAGCCCGAGAGGCAGGG + Intronic
1070856542 10:79611700-79611722 TGGGCAGAGCCCGAGAGGCAGGG - Intronic
1073136536 10:101223519-101223541 TGGGCAAAAGCTGAGGGGCTTGG - Intergenic
1075340641 10:121644636-121644658 TGGGCATAGCCCAGGCTGCTGGG - Intergenic
1076841144 10:133046208-133046230 AGGGCAGAACCCGGGTGGCTGGG - Intergenic
1084153505 11:67302046-67302068 GGGGCAGAAGCCGAGGGGCTGGG - Intronic
1084270144 11:68024913-68024935 TGGTCACAACCCAAGAGGCTGGG - Intronic
1084937319 11:72594010-72594032 TGAGCATAACCCCAGCTACTTGG - Intronic
1090081907 11:123619061-123619083 TGAGCATAACTCCAGCTGCTGGG + Intronic
1092725431 12:11480926-11480948 TGGGCATATCTAGAGAGGCTGGG - Intronic
1103507942 12:121454032-121454054 TGGGCATCAGCCAAGTGGCTTGG - Intronic
1113655040 13:112062801-112062823 TGGCCATCACCCGAGCGCCCTGG + Intergenic
1122329935 14:100905066-100905088 TGAGGATAGCCAGAGCGGCTTGG + Intergenic
1122561572 14:102618789-102618811 GGGGCATAAACCTAGGGGCTTGG + Intronic
1123104469 14:105832655-105832677 TGGGCATAATCCCAGCTACTTGG - Intergenic
1135508383 16:23059358-23059380 TGGTCATAACCCCAGCAGCTGGG + Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1143527187 17:7479508-7479530 CGGGCAAAACCGGAGCGGCCGGG - Intronic
1146388567 17:32400014-32400036 TGGGCATAATCCCAGCTACTCGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1149612995 17:57971339-57971361 TGGGCCTTACCTGAGCTGCTTGG + Intergenic
1151059710 17:71078008-71078030 TGGGCATGACCAGACTGGCTTGG - Intergenic
1165824329 19:38697200-38697222 TGGCCAGAACCCAAGCGGCGAGG + Intronic
1167464479 19:49642834-49642856 TGGGCATAACCCAACCCCCTAGG - Intronic
1168417741 19:56179925-56179947 TGGGCATAATCCCAGCTACTTGG - Intronic
931371419 2:61666812-61666834 TGGGAATAACTCTAGGGGCTTGG - Intergenic
931633591 2:64322623-64322645 TGGGCATAACCCCAGTCGGTGGG + Intergenic
1176007299 20:62873108-62873130 TGGGCAGAAGCAGAGGGGCTTGG + Intergenic
1184092921 22:42301785-42301807 CGGGCAAAACCCGAGCAGATGGG + Intronic
967114309 3:186322837-186322859 TGGGCATAACCCGAGCGGCTGGG - Intronic
1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG + Intergenic
1011812546 6:91149813-91149835 TGGGCAACACCAGAGGGGCTTGG - Intergenic
1017473258 6:154761358-154761380 TGCCCATAATCCCAGCGGCTCGG + Intronic
1035489178 7:159257399-159257421 TGGGCATAACCTCAGTGGTTGGG + Intergenic
1040548641 8:48421658-48421680 TGGGCATTACTAGAGAGGCTAGG + Intergenic