ID: 967114975

View in Genome Browser
Species Human (GRCh38)
Location 3:186328893-186328915
Sequence ATTTCCTTCAAGAAAAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 442}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967114971_967114975 -3 Left 967114971 3:186328873-186328895 CCGGCCTTACACCATTCTTTATT 0: 1
1: 0
2: 0
3: 32
4: 320
Right 967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG 0: 1
1: 1
2: 1
3: 35
4: 442
967114970_967114975 -2 Left 967114970 3:186328872-186328894 CCCGGCCTTACACCATTCTTTAT 0: 1
1: 0
2: 5
3: 39
4: 375
Right 967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG 0: 1
1: 1
2: 1
3: 35
4: 442
967114972_967114975 -7 Left 967114972 3:186328877-186328899 CCTTACACCATTCTTTATTTCCT 0: 1
1: 0
2: 3
3: 48
4: 536
Right 967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG 0: 1
1: 1
2: 1
3: 35
4: 442
967114969_967114975 6 Left 967114969 3:186328864-186328886 CCACTGCGCCCGGCCTTACACCA 0: 1
1: 3
2: 52
3: 479
4: 2926
Right 967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG 0: 1
1: 1
2: 1
3: 35
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967114975 Original CRISPR ATTTCCTTCAAGAAAAGTTA GGG Intronic
903594446 1:24483430-24483452 GTTTCCATCAAAATAAGTTACGG + Intergenic
903630065 1:24761739-24761761 ATTGCCATCAAGAAAGGTGATGG + Intronic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
906469231 1:46113607-46113629 ATTGTCTTCAACAAAACTTAAGG + Intronic
906990468 1:50731814-50731836 ATTTACTTCAAAACAATTTATGG - Intronic
908689634 1:66763884-66763906 ATTTCCTTCAAGAACTTTTCAGG + Intronic
908956876 1:69642442-69642464 ATTACCTTCAAGCAAAAGTAAGG + Intronic
909436617 1:75649471-75649493 ACTTCCTTCAAGAAATGGAAAGG + Intergenic
910062388 1:83109617-83109639 ATTTCCATCTAGACAAGTAAAGG - Intergenic
910078843 1:83314698-83314720 ATATTATTCGAGAAAAGTTAAGG - Intergenic
910506736 1:87958168-87958190 TGTTACTTCTAGAAAAGTTAAGG - Intergenic
910511322 1:88008812-88008834 TTTTCCTAGAAGAAAAGCTATGG - Intergenic
910682941 1:89886031-89886053 TACTCCTTAAAGAAAAGTTAAGG + Intronic
911099674 1:94085219-94085241 ATTTGCTTCAAAAAAACTTCAGG + Intronic
912488962 1:110050746-110050768 ATTTCCTGCAGGAAAAGTCTAGG + Intronic
913376249 1:118155847-118155869 TTTTCCTTCAAAAAAAGTCTTGG + Intronic
914725788 1:150326613-150326635 TTTTCCCTCAGGAAAAGTAATGG - Intronic
914978693 1:152392527-152392549 ATTTCCCTCAAGAAAGGTTGGGG - Intergenic
915499259 1:156303458-156303480 ATTTCCTTAAAGAACTTTTAGGG - Intergenic
917294631 1:173505839-173505861 ATTTCCTTCATGGTAAGATAGGG - Intronic
917766115 1:178219345-178219367 ATTTCCTTCAAGAACTTTTCAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918599053 1:186331446-186331468 ATTTCATTCACGAAAAGCAACGG + Intronic
919295904 1:195699485-195699507 AGTTCCTTCAAGAAAGGGAATGG + Intergenic
919444259 1:197682087-197682109 AGTTGCTTCAAGAAAAAATAAGG + Intronic
919478140 1:198054408-198054430 ATTTCCTTAAAGAGAAGTTTTGG + Intergenic
920158026 1:203971739-203971761 ATTTTCTTCAATAAATGGTATGG + Intergenic
921278085 1:213538831-213538853 ATTTCCTTCAAAATAAGTATAGG - Intergenic
922331564 1:224581312-224581334 TTTTACTTCAAGAAATGTCAGGG - Intronic
922427349 1:225511167-225511189 ATTTCATTCCAGAATAGATAAGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923349954 1:233094560-233094582 ATTTTTTTTAAAAAAAGTTAGGG + Intronic
924100313 1:240596289-240596311 TTTTCCCACAGGAAAAGTTAAGG + Intronic
924242459 1:242054432-242054454 TTTGCCTACTAGAAAAGTTATGG - Intergenic
924312675 1:242761166-242761188 ATTTGGTTCCATAAAAGTTAAGG - Intergenic
1062846469 10:711063-711085 GTTTCCTTCTAGGAATGTTAGGG + Intergenic
1062970119 10:1641443-1641465 ATTTCCTTCAAAAAATGCTGTGG - Intronic
1063567746 10:7186069-7186091 ATTTCTTTCTATAAAAGGTACGG + Intronic
1063876894 10:10488994-10489016 ATTTCCTCCAAGCAAGGCTATGG + Intergenic
1065918475 10:30371131-30371153 ACTTCCATCAAAAACAGTTATGG + Intronic
1066286097 10:33967613-33967635 ATGTTCTTCAAGAATATTTAAGG - Intergenic
1066411723 10:35176913-35176935 TTTAACTTCAAGAAATGTTAAGG - Intronic
1067465398 10:46494558-46494580 ATTTCCATCTGGAAAAGATATGG + Intergenic
1067621789 10:47890043-47890065 ATTTCCATCTGGAAAAGATATGG - Intergenic
1068158807 10:53237043-53237065 GTTTCCTTGAAGAATAGTAAGGG + Intergenic
1068212586 10:53940443-53940465 AGTTCCTTCAGGATTAGTTAAGG + Intronic
1068224225 10:54085843-54085865 ATTTCATTAAAGGAAAGTAATGG + Intronic
1068994008 10:63181647-63181669 ATTTCTTTCGAGAAAATTTCAGG - Intronic
1069219762 10:65868746-65868768 AGTTCCTTCAAGAGAAATTCCGG - Intergenic
1070259510 10:74841117-74841139 ATTGCCTACAAGTAAAGTGATGG + Intronic
1071133903 10:82430897-82430919 CTTTCCATAAATAAAAGTTAAGG - Intronic
1072101752 10:92235864-92235886 ATTGCTGTCAAGAAAAGTTTAGG - Intronic
1072335773 10:94396642-94396664 TTCTTCTTCAAGAAAAGTCATGG + Intergenic
1074323365 10:112423809-112423831 TTCTGCCTCAAGAAAAGTTAAGG - Intronic
1075491462 10:122874460-122874482 ATTTTCTTAAACAAAAGCTAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078845818 11:15117628-15117650 ATTTCCTTCAACAAAGGATGTGG - Intronic
1078936717 11:15957721-15957743 TTTTCATGCAAGAAAAGTCAAGG + Intergenic
1079197075 11:18338364-18338386 ATTTCCTTAAAGGAAAGTAATGG + Intronic
1079498067 11:21068817-21068839 ATTTCCTTCAGGCAAACTTTAGG - Intronic
1080186483 11:29493342-29493364 ATTTGTTTCAAAAAAAGTTATGG + Intergenic
1080255499 11:30286067-30286089 ATTTCCTTCAAAATAACTCATGG + Intergenic
1080526104 11:33121065-33121087 TTTTCATTCAAGAAAAGTAATGG - Intronic
1081562733 11:44233280-44233302 ATTTCATGCAAGAAAAGGCATGG - Intronic
1081887464 11:46510949-46510971 TTTTCCTTGAAGAAAACTTAAGG - Intronic
1082096119 11:48130743-48130765 ATTTCCTTTAAGAAACATGATGG - Intronic
1082193671 11:49276390-49276412 ATTTCCCTGAAGAAATGTAATGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082897217 11:58204781-58204803 ATTAGCTTCAAGAAAATTTAGGG + Intergenic
1082898076 11:58214152-58214174 ATTAGCCTCAAGAAAATTTAGGG - Intergenic
1084697735 11:70765830-70765852 ATGTCATTCAAGAAAAGTGTTGG - Intronic
1086249095 11:84793121-84793143 ATTTCTTTCAAAAAAATTTTCGG + Intronic
1086806239 11:91246401-91246423 ATCTCATTCAAGTAAAATTAAGG - Intergenic
1086899015 11:92345301-92345323 AGCTCCTTGAAGAAAAGTTATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087450706 11:98318799-98318821 ATTTCATACATGAAAATTTAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090893506 11:130948705-130948727 ATTCCCTTCAGGTAAAATTAGGG - Intergenic
1092494785 12:8982374-8982396 ATTTCCTTCTGGGAAAGTCAAGG - Intronic
1093009826 12:14095022-14095044 AATTCCTACAAGAAAACATAAGG + Intergenic
1093046300 12:14449242-14449264 AATTCCTACAAGAAAACATACGG - Intronic
1093140080 12:15499319-15499341 ATTTCCTTCAACTACTGTTATGG - Intronic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1093733860 12:22596068-22596090 ATCTCGATCAAGAAAAGTAATGG - Intergenic
1094243844 12:28263102-28263124 TTTTCTTTCAAGAAAAAGTATGG + Intronic
1095273550 12:40251617-40251639 ATTTCTAACAATAAAAGTTACGG - Intronic
1095786573 12:46116093-46116115 GTTTCCTTCAAGAATTTTTATGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097587731 12:61534462-61534484 AGTTCCTTCAGGAGATGTTATGG - Intergenic
1097891607 12:64782211-64782233 ATTACTGTCAAGAAATGTTATGG - Intronic
1097989433 12:65819497-65819519 ATTCCTTTCAACAAAAGTCATGG - Intergenic
1099420112 12:82446915-82446937 ATTTGTTTCAAGAAATTTTAAGG - Intronic
1099456487 12:82869146-82869168 ATTTACTTTAAGAAAACTTGAGG + Intronic
1099678758 12:85796235-85796257 ATTTCTTTCCAGATTAGTTAGGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101453476 12:104804991-104805013 AATTCCTTAAAAAAAAATTAAGG + Exonic
1102380259 12:112459409-112459431 ATTTGCTTCAAGACAAGTCAGGG - Intronic
1103855832 12:123970784-123970806 ATTTCTGGCAAGAAAAGTCATGG - Intronic
1103874281 12:124115238-124115260 ATTTCCTTCATCACAATTTATGG - Intronic
1105870655 13:24503334-24503356 TTCTCCTTCAAGAATAGATATGG + Intronic
1106677084 13:31972080-31972102 AATTCCTTTATGAAAAGTGAAGG - Intergenic
1107309067 13:39057157-39057179 GTTTTCCTCAAGAAATGTTATGG + Intergenic
1107516699 13:41136292-41136314 ATTTTCTTCTACAAAGGTTAAGG - Intergenic
1107699024 13:43028686-43028708 GTTTCCTTCATGAAATTTTATGG + Intronic
1107708492 13:43130477-43130499 ATTTCTTTCAAAAAAAGCGATGG - Intergenic
1108096480 13:46906955-46906977 GTTTCCTCAAAGAAAAGTCATGG + Intergenic
1108570439 13:51744239-51744261 ATTTCTTTGATGAAAAGTTTAGG - Intronic
1108863620 13:54894724-54894746 AATTCTTTCAAGAAAAGTTTAGG - Intergenic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1109735385 13:66477767-66477789 ATTAGCTTCAAGAAAAGATAAGG + Intronic
1110114568 13:71796256-71796278 GTTTCTTTAAAGAAAAATTAAGG + Intronic
1110513783 13:76384606-76384628 AATTCCTTCAAGGAATTTTAAGG + Intergenic
1111195175 13:84866989-84867011 ATTTCTTTCAATAAAAAATATGG - Intergenic
1112034447 13:95484410-95484432 TTTTCCTTTAAGAAAGATTAGGG - Intronic
1112097924 13:96155566-96155588 TTTTCCTTTAAAAAAGGTTAAGG + Intronic
1112631390 13:101164847-101164869 ATTTACATCATGGAAAGTTATGG + Intronic
1112685972 13:101827526-101827548 ATTTACTTCAAGAAAGAGTAAGG + Intronic
1112865416 13:103890251-103890273 ATTTCCTAATAGACAAGTTAAGG + Intergenic
1115810275 14:37099352-37099374 ATTTCCTTCCAGCAAAGTACGGG - Intronic
1116083599 14:40206017-40206039 ATCTGCTTCAAGTAAAGTTTAGG - Intergenic
1116191368 14:41672804-41672826 ATTTTCTTCAAGAGAAATGATGG + Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116409324 14:44602728-44602750 ATTTCCCTCAAGTATGGTTATGG - Intergenic
1117190017 14:53280201-53280223 ATATTCTTCAAGACATGTTAGGG + Intergenic
1117853415 14:60000657-60000679 ATTTTCTTCAAAAAAATTTTTGG - Intronic
1118335393 14:64849440-64849462 AGTCCCTTCAAGAAAAGATAGGG + Intronic
1119538176 14:75419818-75419840 ATCTCATTGAACAAAAGTTATGG - Intergenic
1120120490 14:80673739-80673761 ATCTCCTTCAAGAAAACCAAAGG - Intronic
1120366307 14:83575248-83575270 ATTTCTTTTAAGAAAAATTCTGG + Intergenic
1120375554 14:83701593-83701615 ATTATCTTCTAGAAATGTTACGG - Intergenic
1120562388 14:86011600-86011622 ATTTCATTCAAGCCAAGTCAAGG - Intergenic
1121179348 14:91916855-91916877 AGTTCCTTAAAGGAAAATTAGGG - Intronic
1122057030 14:99106560-99106582 ATTTCCTTCATGAATAATGAGGG - Intergenic
1122435808 14:101696421-101696443 CTGTCCTACAAGAAATGTTAAGG + Intergenic
1123828766 15:24111204-24111226 ATTTCATGAAAGAAAAATTAAGG - Intergenic
1125240974 15:37575440-37575462 ACCTCCTTCAAGAGAAGTTGCGG + Intergenic
1126184044 15:45813311-45813333 ATGTCCTGCAAGAAATGCTAAGG + Intergenic
1126426982 15:48538317-48538339 AGTTCCTTCAATAAAAGAAATGG + Intronic
1127097906 15:55532235-55532257 ATTTTCTTCTAGAAATGTTATGG + Intergenic
1127510788 15:59638919-59638941 TTGTCCTTAAAAAAAAGTTATGG + Exonic
1128647951 15:69390840-69390862 TTTTCTTTCAAGAAAACTCATGG + Intronic
1128831160 15:70770125-70770147 ATTTCCTTCCAGAAAGGGAAGGG - Intergenic
1129125683 15:73438975-73438997 ATTTTCTTCCAGAAACTTTATGG - Intergenic
1129979929 15:79859446-79859468 ATTTTGTTCATGAAAAGGTAGGG + Intronic
1130836754 15:87657833-87657855 TTTTTCTTCAAGAAAATTAATGG - Intergenic
1131596159 15:93800444-93800466 CTTTCATGCAACAAAAGTTATGG + Intergenic
1131818180 15:96244754-96244776 ATGACCTTCAAGAAAAACTATGG - Intergenic
1132174014 15:99693677-99693699 ATTTCCTCAAACAAAAGTCATGG + Intronic
1134297965 16:12963321-12963343 TTTTCCTCCAAGAAAAGCTGGGG + Intronic
1134826657 16:17290213-17290235 ATTTCAACCAAGGAAAGTTAGGG + Intronic
1136637049 16:31530899-31530921 TTTTCCTTCAGGAACAGTAATGG - Intergenic
1138258086 16:55587346-55587368 ATTACCTTCACGTTAAGTTATGG - Intergenic
1138342988 16:56302941-56302963 TTATCCTCCCAGAAAAGTTAAGG - Intronic
1139179055 16:64724418-64724440 ATTACTTTAAAGCAAAGTTAAGG + Intergenic
1139540373 16:67610870-67610892 CTTTCCTTTAATAAAAGTTTCGG - Exonic
1139874999 16:70138744-70138766 CGTTTCTTCCAGAAAAGTTAAGG + Intronic
1140360786 16:74342387-74342409 CGTTGCTTCCAGAAAAGTTAAGG - Intergenic
1140545534 16:75805236-75805258 GTTTCCTTTAAGGAAAGATATGG + Intergenic
1143208779 17:5167391-5167413 AAATCTTTCAAGAAAAGTTATGG + Intronic
1144528760 17:16015393-16015415 ATTTCCTAGAAGAAACTTTAAGG + Intronic
1147770230 17:42862795-42862817 ATTCACTCCAAGAAAAGTAAAGG - Intergenic
1149002119 17:51768092-51768114 ATTTCCTTCGGGAAAAGTTCGGG + Intronic
1149106673 17:52975622-52975644 ATTTCCTCTAAGAAAAATTCAGG - Intergenic
1149415296 17:56453424-56453446 ATTTAATTCAAGAATAGTTTGGG - Intronic
1150385094 17:64752825-64752847 ATTTGCTTCAAAATAACTTAGGG + Intergenic
1150771488 17:68045205-68045227 ATTTGCTTCAAAATAACTTAGGG - Intronic
1150883702 17:69060415-69060437 ATTTTCATCAAGAAAACTTAAGG - Intronic
1153394806 18:4606885-4606907 TTTTCTTTCAGGAAAATTTAAGG - Intergenic
1154999428 18:21672261-21672283 ATCTCCTCCAAGAATAGCTAGGG - Intronic
1155283400 18:24264398-24264420 ATGCCCTTCAACAAAAATTAAGG + Intronic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157652556 18:49349319-49349341 ATTTATTTCAAGAAAATTTATGG - Intronic
1157986562 18:52445175-52445197 ATTCCTTTCAAGAGAATTTATGG + Intronic
1158332948 18:56383024-56383046 ATTTGCTTCAGTCAAAGTTAAGG - Intergenic
1158783917 18:60685755-60685777 AATTCCTTCATGAATATTTAGGG - Intergenic
1159439771 18:68463042-68463064 AGATCCTTCAAGGAAAGTTTTGG - Intergenic
1159454779 18:68647256-68647278 ATTTCCATCATAAAAAGGTATGG - Intergenic
1159723189 18:71919359-71919381 CTCTCCTTGATGAAAAGTTAAGG + Intergenic
1159787998 18:72738275-72738297 ATCTACTCCAAGTAAAGTTACGG - Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1165108898 19:33489809-33489831 CTTTCCTTCAAGAAAAATCAAGG + Intronic
1167804537 19:51771543-51771565 ATTTCCTGTAAGCAAAGTAAAGG - Intronic
1168196214 19:54775833-54775855 ATTTCTTCAAAGAAAAGTAAAGG - Intronic
1168415797 19:56167392-56167414 ATTTCCTCCAAGCTGAGTTAGGG + Intergenic
925695924 2:6578245-6578267 ATTTACTTAAAAAAAAGGTATGG - Intergenic
925830939 2:7895079-7895101 TTTTCCTTCAGGAAAATTTGGGG + Intergenic
927901363 2:26821388-26821410 ATTGCCATCAAGAAAAGTTTTGG - Intergenic
928065963 2:28164819-28164841 ATTTACTTTAAGAAAAGTTATGG - Intronic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
928461507 2:31477516-31477538 AAGTCCTTCAGTAAAAGTTATGG + Intergenic
928841653 2:35612969-35612991 ATGTCCTTTAAGAAATGATATGG + Intergenic
929015616 2:37491315-37491337 ATTTCCTAAAAGAGAAGTCAGGG - Intergenic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
929673084 2:43894544-43894566 AATTCCCTCATGAAAAGCTATGG - Exonic
931710593 2:64986863-64986885 CTTTTCTGCAAGAAACGTTAGGG - Intergenic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
935833700 2:107026663-107026685 ATTTCATTCAGGCAAAGTGAAGG + Intergenic
939159490 2:138569581-138569603 CTTACCTTCAAGGTAAGTTATGG + Exonic
939160318 2:138580597-138580619 ATTTTCTTAGAGGAAAGTTATGG - Intergenic
939421345 2:141974390-141974412 ATTTGGTTCAAGAAGATTTAAGG + Intronic
939453661 2:142404533-142404555 ATGTCCTCCAAGAAAATTTTAGG - Intergenic
939945239 2:148401265-148401287 AATTCCTTCAAGAAATCTTGCGG + Intronic
940232827 2:151476155-151476177 CTTTCCTTTAAGAAATCTTAAGG - Exonic
940367775 2:152867787-152867809 ATTCCCTTCAAGAATTGTCATGG + Intergenic
941081654 2:161068326-161068348 ATTTCCTTCTAGAGAAGAAAGGG - Intergenic
941484181 2:166059014-166059036 ATTTCATTCCAAAAAACTTAAGG + Intronic
941628283 2:167854733-167854755 ATTTCCAGGAAGAAAAGCTAAGG + Intergenic
941742837 2:169054181-169054203 ATTTCTTTAAAAAAAAATTACGG - Intergenic
942183598 2:173403387-173403409 ATTTCTTTCCACAAAAGTTGGGG - Intergenic
943272987 2:185831026-185831048 AGTTCCTCCAAGAAGACTTAAGG - Intronic
944248709 2:197559559-197559581 AGTTCCTACAAGAAAACATAGGG - Intergenic
944874904 2:203953030-203953052 ATCTCCTTAAAGAAAATTCAAGG + Intronic
945055884 2:205868690-205868712 ATTTTCTCCAAGAAAACTTAAGG - Intergenic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
946508743 2:220331394-220331416 ATTTGTTTCAAGAAAATTTTTGG + Intergenic
946664601 2:222035654-222035676 ATTTCCTTCAACAAAGGGTGAGG - Intergenic
947178807 2:227394024-227394046 ATTTCATGCAAGAACAGATAGGG - Intergenic
948335867 2:237206715-237206737 GTTTCCTTCTAGAAAACTTGGGG + Intergenic
1169008435 20:2229281-2229303 ATTCACTTGAAGAAAAATTAAGG + Intergenic
1169218916 20:3809642-3809664 ATTTCTTTCAAGATAAGGTCTGG + Intergenic
1169638483 20:7721543-7721565 GTTTCCTTCAAGAAGACATATGG + Intergenic
1169858269 20:10126399-10126421 AGTACCTTCAAGGAAAGATAAGG + Intergenic
1171037145 20:21724107-21724129 CTTTCTTTCCAGAAAAGTTTGGG - Intergenic
1176692333 21:9930244-9930266 ATTACCTTCAAAAAATGTTTAGG + Intergenic
1177425682 21:20920461-20920483 ATTTCCTTTTGGAAAAGCTAGGG + Intergenic
1179340419 21:40503038-40503060 ATTTCCTTAAAGGAATGCTATGG - Intronic
1181143373 22:20824599-20824621 ATTTACTTAAAGGAAAGGTAAGG - Intronic
1181186015 22:21104324-21104346 AATTCCTGTAAGAAAAGATAGGG - Intergenic
1182154706 22:28060035-28060057 AGTTCTTTCAATAAATGTTAAGG - Intronic
1183316471 22:37139726-37139748 ATTTTCTTCCAGAAAATTCAAGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184658086 22:45952215-45952237 ATTTCCCTCAAGAAAAGGGCGGG - Intronic
949587985 3:5461834-5461856 ATTTTCTTCTAGAAATTTTATGG - Intergenic
949595236 3:5537449-5537471 ATTTACTCCAAGAAAATTTAAGG - Intergenic
949803528 3:7929603-7929625 ATTGCCTGCAATAGAAGTTATGG - Intergenic
951179894 3:19647076-19647098 AATGACTTCAAGAAATGTTATGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951276082 3:20688153-20688175 ATTTCCATCAAGAACATTTCTGG + Intergenic
951990429 3:28670688-28670710 ATTTCCTTGTAGGAATGTTAAGG + Intergenic
955718369 3:61855264-61855286 AATTCCTACAAGAAAAGGAAAGG - Intronic
955998036 3:64698066-64698088 ATTTCCTTCTAGATCAGTTTTGG - Intergenic
956188543 3:66585638-66585660 ATTTTCTTCAAGAAAAGGTGGGG - Intergenic
959193428 3:103145081-103145103 AGACCCTTCAAGAAAAATTAAGG + Intergenic
959246238 3:103872862-103872884 ACTTACTTCAATCAAAGTTAAGG - Intergenic
959249025 3:103916545-103916567 ATTACAATCAAGAAGAGTTAGGG - Intergenic
959458773 3:106597959-106597981 CTTTCATTGAAGAAAAGTTGAGG - Intergenic
959572888 3:107904419-107904441 ATTTGCTTCAAGATAATCTAAGG + Intergenic
959694003 3:109230415-109230437 ATTTACTTCAAAAAAAAATATGG + Intergenic
959986423 3:112577649-112577671 ATTTCCTCAAAGAGAAGGTATGG + Intronic
960105448 3:113790751-113790773 AGTTTCTTCAAGAAGACTTATGG + Intronic
960251328 3:115458615-115458637 ATTTCTTTCAAAAAATTTTAGGG + Intergenic
960658449 3:120032074-120032096 ACATCCTTCAAAAAAAATTAAGG - Intronic
960927467 3:122809179-122809201 TTTTCTTTCTAGAAAATTTAGGG + Intronic
962583817 3:136820909-136820931 AATTCCTTAAAGAAAGCTTAAGG + Intronic
962969910 3:140390061-140390083 CTTTCCTTAAAGAAAAGTCCAGG - Intronic
963861760 3:150317994-150318016 ATTTTCTTTAAAAAAATTTATGG + Intergenic
963962553 3:151325293-151325315 ATAACCTTCAAGAAAAGAGAGGG - Intronic
964406606 3:156354800-156354822 ATTTCGTTCCAGAAAAACTAAGG + Intronic
964542370 3:157793657-157793679 TTTTCCTTCAAGCAAAGTAATGG - Intergenic
964938691 3:162127214-162127236 ATTTCCTTCTAGGATTGTTAAGG + Intergenic
964989646 3:162792935-162792957 ATTTCCTTAATGATAAATTATGG + Intergenic
965466308 3:169034786-169034808 ATTTCTTACAAGAGAATTTAGGG + Intergenic
965715988 3:171603644-171603666 GCCTCTTTCAAGAAAAGTTAGGG - Intronic
966403021 3:179565813-179565835 AAATCCTTCAAAAAAAATTAGGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966650292 3:182293272-182293294 ATTTGCTGCAAGAAAATTCAGGG - Intergenic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
967696735 3:192541684-192541706 ATGTCCTCCAAGAAATGTAAGGG - Intronic
969762272 4:9196970-9196992 ATATCCTTCAAATAAAGTGACGG - Intergenic
970700828 4:18736101-18736123 ATTTCCTTCAAATTAAGATAAGG - Intergenic
971517866 4:27511456-27511478 ACCTGCTTCAAGAAAAGGTATGG - Intergenic
971714443 4:30157524-30157546 ATTTCCTCCAAGAAAAGTTATGG - Intergenic
971764658 4:30814852-30814874 ATTTGCTTTAATAAAAATTATGG - Intronic
971830686 4:31688881-31688903 ATTTCCTTTCTGAAAATTTATGG - Intergenic
972526045 4:39912600-39912622 ATTTACATCAAGAAAAATTCTGG + Intronic
972850411 4:43042339-43042361 ATTTCCTTCAGGACATGATATGG + Intergenic
973140254 4:46758485-46758507 ATTTCCATCACCAAAAGTTCAGG + Intronic
974356773 4:60822909-60822931 ATTTTCTTCAAGAAACATTTTGG + Intergenic
974658610 4:64858038-64858060 ATTTGCTTCACGCAAAGGTAAGG + Intergenic
974697038 4:65389658-65389680 ATTTGCTTCAGGAAAAATCAAGG + Intronic
974844693 4:67337652-67337674 TTTACCTTCAAGAAAATTCATGG - Intergenic
974849450 4:67386975-67386997 ATTTCCATCAATACATGTTATGG - Intergenic
974996465 4:69165777-69165799 ATTTCCTGGAAGAAAATGTAGGG + Intronic
975009448 4:69330719-69330741 ATTTCCTGGAAGAAAATGTAGGG + Intronic
975991021 4:80260531-80260553 TTTTCTTTCAGGAAAAGTTTAGG - Intergenic
976358510 4:84149177-84149199 ATTTTACTCTAGAAAAGTTATGG + Intergenic
976732584 4:88279139-88279161 ATTGCTTTAAAGAAAAGGTAGGG + Intronic
977082020 4:92542330-92542352 ATCACATTCAAGAAAAGTTTAGG - Intronic
977797304 4:101182063-101182085 ATTTTTTTAAAGAAAAATTAAGG - Intronic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978730103 4:112015844-112015866 ATTTCCATTAAAAAAAGTTGAGG + Intergenic
979490139 4:121316677-121316699 ATATCCTCCAAGAAATTTTAAGG + Intergenic
980364929 4:131790482-131790504 ATTACCTTCAAAAAATGTTTAGG + Intergenic
980977634 4:139626058-139626080 ATTTCCTTGAAGATTAGTGATGG - Intergenic
981211174 4:142107585-142107607 ATTTTATGCAAAAAAAGTTAAGG - Intronic
983810540 4:172055380-172055402 ATTTACTTCAAGAAAATTGTTGG - Intronic
984663605 4:182401181-182401203 TTTTCATTCATGAAAAGCTAAGG - Intronic
985008057 4:185554270-185554292 GTTTTCTTTGAGAAAAGTTAGGG + Intergenic
985811378 5:2091151-2091173 AATTCCTTCCAAAAATGTTATGG - Intergenic
985870765 5:2554511-2554533 TATTCCTTCAAAAATAGTTAAGG - Intergenic
987775273 5:22358102-22358124 ATTTCCTTAAAGAATACTAATGG + Intronic
987789932 5:22552109-22552131 ATTTTCTTAAAGAAAAGCTCAGG - Intronic
988096218 5:26614066-26614088 ATTTCCTTAAGAATAAGTTAGGG + Intergenic
988144332 5:27285395-27285417 ATTTACTTCTACAAAAATTATGG + Intergenic
988946849 5:36212150-36212172 AATTGCTTCAAGAAGAATTAAGG - Intronic
989287144 5:39714596-39714618 ATTTCCTTAAGGAAATGTTGTGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990486082 5:56260483-56260505 ATTTACTCCATGGAAAGTTAAGG + Intergenic
990902327 5:60765801-60765823 ATTTCCTACAAGAAATATCATGG + Intronic
991218930 5:64189934-64189956 TTATCCTTCAACAAAAGATAAGG + Intronic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
992477260 5:77115906-77115928 ATTTCATTCAAGAAGGTTTATGG + Intergenic
992539846 5:77753301-77753323 ATTGACTTAAAGAAAAGTAAGGG - Intronic
992690939 5:79239297-79239319 ACTTCCTTCAAAATAATTTAAGG - Intronic
992708411 5:79422440-79422462 AATTTCTTCAAGACAGGTTAAGG + Intronic
992944891 5:81800303-81800325 ATTTCTTCCTAGACAAGTTATGG - Intergenic
993009446 5:82463517-82463539 ATTTTCTTCTAGAATACTTATGG - Intergenic
993115457 5:83715023-83715045 GTTTCCTTCCAGAAATGTGAAGG - Intronic
993274302 5:85836465-85836487 GCTTCCTTTAATAAAAGTTAGGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
993897030 5:93548107-93548129 ATTTCCTTCAGGAAAACTGAAGG - Intergenic
993898468 5:93568427-93568449 ATTTCCTTGATGAAAACTAATGG + Intergenic
994849111 5:105031100-105031122 TTTTCCATCAAGAAAAATGAAGG - Intergenic
995619550 5:114009046-114009068 ATTTCCTCTAAGATAAGATAAGG + Intergenic
996237620 5:121151690-121151712 ATTTCCTGTAAGAAAAGTAGTGG - Intergenic
996707207 5:126509539-126509561 ACATCCTTCAAGAAAAGTGTGGG + Intergenic
997261237 5:132466861-132466883 ATTTCCTTTGAGAAAAGATTCGG - Intronic
997839270 5:137224160-137224182 ATTTCCCTGTAGAAAAGTTGTGG - Intronic
1000816177 5:165924863-165924885 ATTTACTTCCAGAAGAATTATGG + Intergenic
1001463183 5:171936936-171936958 AATTCCTTCAATCAATGTTATGG + Intronic
1003178290 6:3770358-3770380 TTTTCCTTAAAGAAAAGATGTGG - Intergenic
1005135268 6:22561345-22561367 ATTTCCTTCATCAAAAATAAAGG + Intergenic
1005224874 6:23630903-23630925 ATTTGCTTCATTAAAATTTATGG - Intergenic
1006421558 6:33937345-33937367 ATGTCTTTCAAAATAAGTTATGG - Intergenic
1007467290 6:42062879-42062901 ATTCCCTTTAACAAAAGCTATGG + Intronic
1008724836 6:54404783-54404805 GTTTCTTTCAAGAAATGTTATGG - Intergenic
1008826324 6:55698305-55698327 ATTTCCTTGAAGAAAGGAGAGGG + Intergenic
1008869417 6:56254712-56254734 ATGACCTTTAAGAAAAGTTAAGG - Intronic
1009389123 6:63124400-63124422 ATTTCCCACAAAAAAAGGTAAGG - Intergenic
1009883931 6:69602327-69602349 AGTTCCTTCAAGACAAATTCCGG - Intergenic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1010669403 6:78669935-78669957 ATTTACTTCAACAAAAGACAGGG + Intergenic
1011163122 6:84414938-84414960 GTTTCCTTTAAGAAAAAATAAGG + Intergenic
1012693197 6:102342785-102342807 ATATCCTTTAAAAAAAGTGAAGG - Intergenic
1012837515 6:104288672-104288694 ATTTCCTACAACAAACGTTATGG - Intergenic
1013059476 6:106618873-106618895 ATTTCATTAAAAAAAAGATATGG + Intronic
1013069829 6:106718664-106718686 ATTTCCTTCATGGCAGGTTACGG + Intergenic
1014289836 6:119545567-119545589 ATTTTCTTAAAGAATATTTATGG + Intergenic
1014648482 6:124005683-124005705 ATTTCCTTCAAGGAAACAAATGG - Intronic
1015435077 6:133176680-133176702 ATTTCTTACAATACAAGTTAGGG + Intergenic
1015675962 6:135749158-135749180 AATTCCTACAAGAAAATGTAGGG - Intergenic
1016365724 6:143315949-143315971 ATTTCCTAAAATAAAAGATATGG - Intronic
1016861653 6:148725905-148725927 TTTTCCATAAAGAAAAGTTGTGG + Intergenic
1017079745 6:150656243-150656265 TTTTCTCTCAAGAATAGTTAGGG - Intronic
1017349540 6:153423503-153423525 ATTTTCTTCTAGAAACTTTATGG + Intergenic
1017650839 6:156581146-156581168 ATTTCCTTTAAGAAAATGTGGGG - Intergenic
1018424177 6:163664944-163664966 CTCTCCTTCAAGAGAAATTAGGG - Intergenic
1018473573 6:164118649-164118671 ATTTCCTTCCACAAAGGTAAAGG + Intergenic
1018885811 6:167935566-167935588 GTTTCTTTAAAGAAAAGTTGAGG - Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1020238670 7:6375241-6375263 ATTTTTTTAAAGAAAAGTTTGGG - Intronic
1020493180 7:8814816-8814838 ATTCCCTTTAAGAAAACTGACGG + Intergenic
1021291996 7:18856933-18856955 ATTTCCTTCAAGGCACTTTATGG - Intronic
1021438583 7:20651055-20651077 ATTTCCTAGAAGAAATGTAAGGG + Intronic
1021581639 7:22160373-22160395 ATTTACTACTAGAAAAGCTAAGG + Intronic
1021659033 7:22899858-22899880 TTTTTTTTAAAGAAAAGTTATGG + Intergenic
1021671947 7:23043514-23043536 AGTTCCTTCAAAAAAATTTCAGG - Intergenic
1022708306 7:32827478-32827500 ATTACATTCTAGAAAAGTCATGG + Intergenic
1022744202 7:33153265-33153287 ACTTCTTTCAAGAAACGATAGGG - Intronic
1022987349 7:35669787-35669809 ATCTACTTCAAGAAGATTTAGGG + Intronic
1023235728 7:38084179-38084201 ATTTCCTTTGAGAAAAATTTTGG - Intergenic
1023494807 7:40783678-40783700 ATTTCCTTTAATAAAACATAGGG - Intronic
1024533530 7:50411569-50411591 ATTTCCCTCAAGAAAGCTTCTGG + Intergenic
1024887847 7:54164724-54164746 ATTGACTTAAAGAAAAGTAAGGG - Intergenic
1024923296 7:54584582-54584604 ATTTGCTTCAATGACAGTTATGG + Intergenic
1025765081 7:64437163-64437185 ATTTCCACAAAGAAAAGTTTAGG - Intergenic
1027492868 7:78852194-78852216 ATTTCATTGAAGAAAAGCAATGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031205646 7:118754145-118754167 ATTTTCATCAAGAAAATATAAGG + Intergenic
1031292966 7:119962304-119962326 ATTTCCATCAAAAAATTTTATGG + Intergenic
1031325159 7:120386793-120386815 ATTTCTTTCAAGGAAACTTCTGG - Intronic
1031595474 7:123644879-123644901 ATTTCCTTTATGAAAATTTTAGG + Intergenic
1031617723 7:123900687-123900709 TTTTTCTTCAAGGAAATTTATGG + Intergenic
1031789297 7:126080097-126080119 ATTTCCTTTATGGAAAATTAAGG + Intergenic
1032071757 7:128812205-128812227 ATTACCTATAAGAAGAGTTACGG + Exonic
1032417392 7:131746841-131746863 ATCTCCTTCAAAAAAAGATATGG - Intergenic
1032778664 7:135143852-135143874 AATTCCTGTAAGAAAAGTGAGGG + Intronic
1033365331 7:140669023-140669045 ATTCACTCCAAGAAAAGTAAGGG + Intronic
1033561230 7:142533856-142533878 GTTTTCTTCAAGAAAGGATATGG - Intergenic
1036478534 8:9117161-9117183 ATTTACTTAATGAAAACTTATGG - Intergenic
1036579094 8:10055731-10055753 TTTTCCTTCAAGAATTGTTGAGG + Intronic
1036844253 8:12152094-12152116 ATATCCTTCAAATAAAGTGACGG + Intergenic
1036865625 8:12394416-12394438 ATATCCTTCAAATAAAGTGACGG + Intergenic
1037007216 8:13797413-13797435 ATTATCTTTAAGAATAGTTATGG + Intergenic
1037375493 8:18223002-18223024 ATTTTCTTCAAAATAAGGTAAGG - Exonic
1037678926 8:21076874-21076896 AAATCCTTTATGAAAAGTTAGGG - Intergenic
1039024773 8:33245797-33245819 TTTGCCTTCAAGAACAGTTCTGG - Intergenic
1039673517 8:39632778-39632800 ATTTCCTCAAAGAAAACTTAAGG - Intronic
1039766542 8:40634128-40634150 ATTATCTTAAAAAAAAGTTATGG + Intronic
1040390896 8:46949721-46949743 ATTTCCTTCCAAAATATTTAGGG + Intergenic
1040950368 8:52933166-52933188 ATTTCTTTAAAAAAAAGTTGGGG + Intergenic
1041188872 8:55332460-55332482 ATGTCCTACAAGAAATTTTAAGG - Intronic
1041789374 8:61675872-61675894 ATTTTCTTCAATAGAAGTTGGGG + Intronic
1042104581 8:65312584-65312606 GTTTCCTTCAAGAAAAGCAATGG - Intergenic
1042430836 8:68704526-68704548 ATTACCTACAAGATGAGTTATGG - Intronic
1043013979 8:74915022-74915044 ATTTCCTACAAGACAATCTATGG - Intergenic
1043752675 8:83960011-83960033 ATTTTCTTTAAGAAAAGCCATGG + Intergenic
1043859419 8:85298612-85298634 ATTTTGTTCGTGAAAAGTTATGG + Intergenic
1043878942 8:85519339-85519361 ATTTTCTGCCATAAAAGTTATGG - Intergenic
1044304201 8:90618753-90618775 CTTTCCTTCATAAACAGTTAAGG - Intergenic
1044952373 8:97446871-97446893 ATTTCATTCAACAGAAGTTTGGG - Intergenic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046570461 8:115959001-115959023 CTTGCCTTAAAGAAAAATTAAGG + Intergenic
1047502184 8:125450773-125450795 ATTTCCTTAATGAATAATTAAGG + Intergenic
1048721038 8:137325438-137325460 GTTACCTTTAAGAAAAGATAGGG - Intergenic
1048938001 8:139372879-139372901 ATGACCTCCAAGAAAAGTCAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051780888 9:20687755-20687777 AGTTCCTTAAAGATAAGTTAAGG - Intronic
1051789052 9:20779208-20779230 ATTGACTTAAAGAAAAGTGAAGG + Intronic
1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG + Intronic
1053121329 9:35549182-35549204 ATTTCCTGGAAGAAAAGTTCAGG + Intronic
1053629281 9:39916333-39916355 ATTACCTTCAAAAAATGTTTAGG + Intergenic
1053776483 9:41547218-41547240 ATTACCTTCAAAAAATGTTTAGG - Intergenic
1054214606 9:62334369-62334391 ATTACCTTCAAAAAATGTTTAGG - Intergenic
1054365250 9:64331267-64331289 ATTACCTTCAAAAAATGTTTAGG + Intergenic
1054473026 9:65553137-65553159 ATTTCATACAAGCAATGTTAGGG - Intergenic
1054672874 9:67820978-67821000 ATTACCTTCAAAAAATGTTTAGG + Intergenic
1055804986 9:80082757-80082779 ATTTCCTTCTAGAATATTTTAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056231413 9:84548693-84548715 GTTTCCTGAAAGAAAAGTTGAGG + Intergenic
1056709457 9:88978927-88978949 ATTCCATTCAATAAAAGTTGTGG + Intergenic
1058207191 9:102122894-102122916 ATCTGCTTCAAGGAAATTTAAGG - Intergenic
1058378461 9:104352565-104352587 ATTTGCTTCAATCAAAGTTTTGG - Intergenic
1058397485 9:104571131-104571153 ATCAAATTCAAGAAAAGTTATGG - Intergenic
1058817688 9:108700467-108700489 ATTTTCTTCTAGAACATTTAAGG + Intergenic
1059096248 9:111417877-111417899 ATTACATCCAAGAAAAGGTATGG - Exonic
1059515154 9:114887195-114887217 ATTTAATTCAAGGAATGTTATGG - Intergenic
1060106315 9:120875791-120875813 ATTTCCTTCCAGAAACTTTCTGG + Intronic
1062603953 9:137334619-137334641 ATTTCCTTCTAGAATGTTTATGG - Intronic
1062620608 9:137419717-137419739 ATTTTCTTCAAGGAAATTCATGG + Intronic
1186859826 X:13661378-13661400 ATTTCCTTAAAGTAAATTTATGG + Intronic
1187428378 X:19199255-19199277 ACTCACTTCAAGAAAAGATAAGG + Intergenic
1188507834 X:30902056-30902078 AGTGCCTGGAAGAAAAGTTATGG - Intronic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1189401637 X:40674909-40674931 CTGTCCTTCAAGACAAGGTAAGG + Intronic
1190474837 X:50815576-50815598 ATTTTATTAAAGAAAAGTCAGGG - Intergenic
1190594129 X:52036060-52036082 ATTTCCTTTAAGATGAGTTCAGG - Intergenic
1191752312 X:64556206-64556228 ATTTTCTCCTAGAAAACTTAGGG - Intergenic
1192378600 X:70589816-70589838 ACTTGCTTAAAGAAAAGTCACGG + Intronic
1193298761 X:79864140-79864162 TTTTCATTCAATAAATGTTAAGG - Intergenic
1193358589 X:80553094-80553116 TTTTTCTTGAAGAAAAATTATGG + Intergenic
1193393169 X:80953753-80953775 ATTACTTTCAAGAATTGTTAGGG + Intergenic
1193525828 X:82587490-82587512 ATTTCATTTAAGACAAGCTATGG - Intergenic
1193659712 X:84242488-84242510 ATCTCCTACAAGAAATGCTAAGG + Intergenic
1194138757 X:90181096-90181118 ATTTCCATAAAAAAAAGTGATGG + Intergenic
1194246617 X:91520083-91520105 AATTACTTCAAGAAAACTTTGGG - Intergenic
1194280563 X:91948041-91948063 ATTTCCTAGAAGCAAATTTAAGG + Intronic
1194427624 X:93759479-93759501 AATTCCTACAAGAAAAGTGTAGG - Intergenic
1194440510 X:93927724-93927746 ATTTCCTACATGAAGAGTCATGG - Intergenic
1196014868 X:110928064-110928086 ATTTTCTTGAAGAAAAATTGGGG - Intergenic
1196397322 X:115278731-115278753 ATTTTCTGCAAGAAAAAATATGG - Intergenic
1196866199 X:120073389-120073411 CTTTCCTTCAAGAAATTCTAAGG + Intronic
1196876898 X:120162892-120162914 CTTTCCTTCAAGAAATTCTAAGG - Intronic
1197527976 X:127586004-127586026 CTTTCATTCAAGAAAATCTAAGG + Intergenic
1198520575 X:137448508-137448530 AATTCCCCCAAGAAATGTTAGGG - Intergenic
1199451735 X:147985323-147985345 TTTTACTTTAAAAAAAGTTATGG + Intronic
1199589792 X:149456765-149456787 CTTTCCATAGAGAAAAGTTAGGG + Intergenic
1199813992 X:151381096-151381118 ATTTACTTTCAGAAATGTTATGG - Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic
1200309269 X:155060948-155060970 AGTTCCTTCATGATAAATTAAGG + Intergenic
1200565576 Y:4761325-4761347 AATTACTTCAAGAAAACTTTGGG - Intergenic
1200598039 Y:5171537-5171559 ATTTCCTAGAAGCAAATTTAAGG + Intronic
1200804476 Y:7418760-7418782 ATTTCCTTCACGAAATCTCATGG - Intergenic
1201253798 Y:12087671-12087693 ATGTGCTTAAAGAAAAGTTATGG - Intergenic
1201316365 Y:12650758-12650780 GTTACCATCAAGAAAATTTAGGG - Intergenic
1201372361 Y:13279081-13279103 ATTTGTTTGAAGAAAAGTAAGGG + Intronic