ID: 967118051

View in Genome Browser
Species Human (GRCh38)
Location 3:186360016-186360038
Sequence CCTCTCCTACTGATGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967118051_967118059 -2 Left 967118051 3:186360016-186360038 CCAACTCCCATCAGTAGGAGAGG 0: 2
1: 0
2: 0
3: 16
4: 123
Right 967118059 3:186360037-186360059 GGGGAGAGTTGCTGGCTTCTGGG 0: 2
1: 0
2: 2
3: 33
4: 277
967118051_967118058 -3 Left 967118051 3:186360016-186360038 CCAACTCCCATCAGTAGGAGAGG 0: 2
1: 0
2: 0
3: 16
4: 123
Right 967118058 3:186360036-186360058 AGGGGAGAGTTGCTGGCTTCTGG 0: 2
1: 0
2: 2
3: 22
4: 267
967118051_967118057 -10 Left 967118051 3:186360016-186360038 CCAACTCCCATCAGTAGGAGAGG 0: 2
1: 0
2: 0
3: 16
4: 123
Right 967118057 3:186360029-186360051 GTAGGAGAGGGGAGAGTTGCTGG 0: 2
1: 0
2: 1
3: 69
4: 496
967118051_967118060 15 Left 967118051 3:186360016-186360038 CCAACTCCCATCAGTAGGAGAGG 0: 2
1: 0
2: 0
3: 16
4: 123
Right 967118060 3:186360054-186360076 TCTGGGTTCTTTCCTCGCAGAGG 0: 2
1: 0
2: 1
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967118051 Original CRISPR CCTCTCCTACTGATGGGAGT TGG (reversed) Intronic
901440177 1:9273021-9273043 CCTCCCCTTCTGCTGGGAGCTGG - Intergenic
901862211 1:12081508-12081530 CCTCTCCTACTGGAGGGAGGAGG + Intronic
902035639 1:13456145-13456167 CCTCACCTGCTGCTGGGAGTCGG - Intergenic
909607637 1:77522615-77522637 CCTCTCCTAGTGAGGAGGGTGGG + Intronic
913128068 1:115811674-115811696 CCTATGCTACTGCTGAGAGTGGG + Intergenic
917922107 1:179759291-179759313 CCTCTCAATGTGATGGGAGTGGG - Intronic
919165304 1:193885030-193885052 CCAGTCCTACAGATGGGAGGGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923705276 1:236339091-236339113 AATCTACAACTGATGGGAGTGGG + Intergenic
1062832856 10:617520-617542 CCACAGCTACTGTTGGGAGTTGG - Intronic
1066681455 10:37939694-37939716 CATCTCCTAGTGGTGGGAGTGGG - Intergenic
1067220875 10:44343433-44343455 CATCTCCTGCTGATGGGGGGAGG + Intergenic
1068535881 10:58241121-58241143 GGTCTCCTACTGCTGGGGGTGGG + Intronic
1068669470 10:59709373-59709395 CCCCTCCTACTGCTCCGAGTCGG + Intronic
1069223659 10:65914231-65914253 CCTTTCCTACAGTTGGGAATAGG + Exonic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1071324276 10:84496593-84496615 CCTCCCTTTCTGATGGGAATGGG + Intronic
1071525521 10:86355847-86355869 CCTCTCCTGCTAATGGCAGTGGG - Intronic
1072620839 10:97078280-97078302 CCTCTCCAGCTGATGGGACCTGG - Intronic
1073175670 10:101555476-101555498 TCTCTCCTGCTGATGGAAATGGG + Exonic
1073333065 10:102683792-102683814 AATCTCCACCTGATGGGAGTTGG + Intronic
1079022954 11:16924265-16924287 CCCCTCCTACTGAGGGGCCTGGG + Intronic
1079254048 11:18811254-18811276 ACTCTCCTACTGCATGGAGTTGG - Intergenic
1079296541 11:19240480-19240502 CCTTTTCTACAGATGGGAGAGGG - Intronic
1079506114 11:21154197-21154219 CCTCTCTTAATGGTGGCAGTGGG + Intronic
1082711614 11:56559986-56560008 CGTCTCCTACTGCTGGAGGTGGG + Intergenic
1083721646 11:64606563-64606585 CCTCTCCTGGTGAGGGGAGTTGG + Exonic
1084877095 11:72141112-72141134 AGTCTCCTACTGATGGGCATTGG + Intergenic
1085218992 11:74856945-74856967 GGTCTCCTACTGCTGGGAGAGGG + Intronic
1085601841 11:77862480-77862502 CCTCTCCAAGTGGTGGGAGGAGG - Intronic
1089340778 11:117755908-117755930 CCTCTGCTGCTGATGGTAGTGGG - Intronic
1093059601 12:14589185-14589207 CCAGTCCTGCTGACGGGAGTGGG - Intergenic
1093337287 12:17921392-17921414 CCCCTCCTACAGCTGGGTGTTGG - Intergenic
1094601051 12:31909196-31909218 CCTCTCCTAATGATGTGCCTAGG + Intergenic
1097184013 12:57187020-57187042 CCTCTCCCACTGAGGGCAATCGG - Intronic
1104288569 12:127447561-127447583 ACTCTCCTACAGAGGGGAGTGGG - Intergenic
1104904846 12:132207654-132207676 CCTCAGCTAATGATGGAAGTTGG - Intronic
1106813907 13:33386601-33386623 CCCCTCCTACTAATGGCAGTGGG - Intergenic
1108497696 13:51041575-51041597 TCTCTCAGACTCATGGGAGTTGG + Intergenic
1114059622 14:19007407-19007429 CCTCACCCACTGAAGGAAGTGGG + Intergenic
1114102924 14:19394344-19394366 CCTCACCCACTGAAGGAAGTGGG - Intergenic
1114552675 14:23542411-23542433 TGTCTGCTACTGATGGGGGTGGG + Intronic
1114655767 14:24314793-24314815 CCCCTCCTAGTGAAGGGAGTGGG + Exonic
1115761626 14:36582451-36582473 CCGCTCCTACGGATGGGCGTGGG + Exonic
1118959259 14:70513882-70513904 TATCTCATACTGATGGGATTGGG - Intergenic
1121023026 14:90593361-90593383 TCTCTCCTAATGAGGGGTGTGGG + Intronic
1121303712 14:92891814-92891836 GTTCTCTTAGTGATGGGAGTGGG - Intergenic
1124241102 15:28028194-28028216 ACTCTCATACTGGTGGGAATGGG + Intronic
1124896905 15:33785816-33785838 CTTGTCCTACTGGTGGGAGCGGG + Exonic
1131264877 15:90910049-90910071 GCTCTAGAACTGATGGGAGTGGG + Intronic
1131641475 15:94298639-94298661 CCTCTCCTGCTGAGCGGAGACGG + Exonic
1134826795 16:17291259-17291281 CCTCTCAAACTGCTGGGTGTGGG + Intronic
1147198482 17:38783457-38783479 CCTATCCTGGTGGTGGGAGTGGG - Intronic
1149483523 17:57023166-57023188 CCTCCCCTAGAGATGGGGGTGGG - Intergenic
1149830840 17:59870472-59870494 CTCCTCCTACTGCAGGGAGTGGG - Intronic
1150313407 17:64148178-64148200 CCTCTCATACAGATGGGATGGGG - Exonic
1150324263 17:64243455-64243477 CCTCAGCTCCTGATGTGAGTGGG + Intronic
1151578198 17:74963293-74963315 CCTCCCCTACTGACTGGAGGGGG + Intronic
1155063714 18:22250977-22250999 CCTCTCCTCCAAATGGGAGTTGG + Intergenic
1155153879 18:23142674-23142696 GCTGTCCTACTCATGGGAGATGG + Intronic
1159263145 18:66042634-66042656 CCTCTTCTATGGAAGGGAGTAGG - Intergenic
1160056943 18:75492235-75492257 CATCTCCTACTGTTTAGAGTGGG - Intergenic
1161557449 19:4952066-4952088 CCTCAGCTTCTGTTGGGAGTAGG + Intronic
1164220070 19:23185505-23185527 CCTCTCTTGCTGAGGGGACTTGG + Intergenic
1165784762 19:38454860-38454882 CCTCTCCAGTTGGTGGGAGTGGG + Intronic
1165994138 19:39832843-39832865 CCACTCCTCCTGATGGGAGAAGG + Intronic
1166922122 19:46236095-46236117 CCACTCCTACTGAAGGGTTTTGG + Intergenic
1167769230 19:51503650-51503672 CCTCTCCAAATTATGGAAGTGGG - Intergenic
930092840 2:47543897-47543919 CTTCTGCCACTGATGGGAGGAGG + Intronic
931428289 2:62190579-62190601 CCTCTCCTTCTGGTGTGACTTGG + Intergenic
938619125 2:133031241-133031263 CCTCTGCTGCTGCTGGGGGTAGG - Intronic
939856603 2:147366243-147366265 CTTCCCCAAATGATGGGAGTAGG + Intergenic
942556695 2:177178885-177178907 CCTCACCTAGTGTTGGGGGTGGG + Intergenic
943803002 2:192086014-192086036 CCTATAGTATTGATGGGAGTTGG - Intronic
946447702 2:219753934-219753956 CCTCTGCTGCAGGTGGGAGTGGG + Intergenic
1169049216 20:2562051-2562073 CAGCTCCTTCTGATGGGAATGGG + Intronic
1169333825 20:4738564-4738586 CATCTCCTAATGATGAGAGGTGG + Intronic
1170495016 20:16915574-16915596 CCAGTCCTGCAGATGGGAGTGGG + Intergenic
1171958371 20:31476290-31476312 CCTCTTGTTCAGATGGGAGTAGG - Exonic
1172590786 20:36116468-36116490 CCTTTCCTCCTGATGTGAGGTGG + Intronic
1176205792 20:63887442-63887464 TCGCTCCAACTGCTGGGAGTGGG + Intronic
1178110325 21:29363665-29363687 CCACTTCTAGAGATGGGAGTGGG - Intronic
1180478102 22:15730019-15730041 CCTCACCCACTGAAGGAAGTGGG + Intergenic
1185215134 22:49594394-49594416 CCTTTCCTGCTGAAGGGTGTTGG + Intronic
953855571 3:46497176-46497198 CCTCTCCTCCTCTTGGGAGGTGG + Intergenic
954803268 3:53199696-53199718 CCAATGCTACTGATGGCAGTGGG - Intergenic
957471057 3:80657787-80657809 CCTTTCCTTCTGGTGGGATTTGG + Intergenic
958041365 3:88230537-88230559 CCAATCCAACTGATGAGAGTGGG - Intergenic
961538330 3:127583623-127583645 CCTTCCCTACTGTTGGGAGGGGG + Intronic
965675412 3:171190172-171190194 ATTCTCCCACTGATGGAAGTGGG + Intronic
967117743 3:186356936-186356958 CCTCTCCTACTGATGGGAGTTGG - Intronic
967118051 3:186360016-186360038 CCTCTCCTACTGATGGGAGTTGG - Intronic
973010408 4:45065755-45065777 CCTCCCCTACTGATGGGTAGAGG - Intergenic
973637888 4:52876894-52876916 CCTCTCCTCCTGCTGTGACTTGG + Intronic
977530863 4:98199222-98199244 CCTCTCTTACTGCTGGGCCTAGG + Intergenic
984450659 4:179897097-179897119 CCTCTCCTGGGCATGGGAGTGGG + Intergenic
990484031 5:56240223-56240245 CCACTCTGACTGATGGGAGATGG - Intergenic
990809756 5:59709694-59709716 CTTCTCCTACTGAGGGGAGGAGG + Intronic
991245863 5:64507334-64507356 CCTCTCCTACTGCTAGGACATGG - Intronic
993384826 5:87251761-87251783 CCAGTCCTGCTGATGGGAGGGGG - Intergenic
993625778 5:90223198-90223220 CCTCTCCTACTGAGTCGAGATGG + Intergenic
996923854 5:128800083-128800105 CCAGTCCCACAGATGGGAGTGGG - Intronic
998542484 5:142995964-142995986 CAGCTCCCACTTATGGGAGTGGG - Intronic
1000341358 5:160279582-160279604 CCTCACCTGCTGAGGGCAGTGGG + Intronic
1000686571 5:164256849-164256871 CCTAACCCACTGAAGGGAGTCGG + Intergenic
1003870909 6:10402492-10402514 CCTCTACTAGTGATGTGAGCAGG + Exonic
1004388895 6:15193035-15193057 CCTCTCCAACTGAGGCAAGTGGG + Intergenic
1005681563 6:28213884-28213906 AGTGTCCTACTGATGGCAGTAGG - Intergenic
1007747617 6:44052641-44052663 CCTCCCCTGCTGTTGGGATTGGG + Intergenic
1008324847 6:50165615-50165637 CCATTCTTACTGATGTGAGTTGG + Intergenic
1010481415 6:76358778-76358800 CCACTGTTACTGATGGGAGCAGG + Intergenic
1013604894 6:111738646-111738668 CCTCACCTAGTGATGGGCTTGGG + Intronic
1014978967 6:127923779-127923801 CCTCTCCTCTTGATGGAAGGTGG - Intergenic
1015984176 6:138869201-138869223 GCTCTCCCTCTGAGGGGAGTCGG + Intronic
1019792336 7:3024227-3024249 CCTCCCCAACTGATAGGAGAAGG + Intronic
1021338020 7:19428085-19428107 CCTCTCTTACTGCTGGAAGCAGG - Intergenic
1022878723 7:34563913-34563935 CCTCTGGTAGTGATGGGAGTGGG + Intergenic
1026567206 7:71499297-71499319 CCTCTCAAAGTGATGGGATTTGG - Intronic
1030793182 7:113755036-113755058 CCTCTCCTTTTGGTGGGAGAGGG + Intergenic
1032204240 7:129847795-129847817 CTTCACCTAATGAAGGGAGTAGG + Intronic
1034228545 7:149501195-149501217 CCTTTCCTTCTGCTGGGAGCTGG + Intergenic
1035474966 7:159136865-159136887 CCTGTCCTGCTGGTGGGGGTTGG - Intronic
1036526990 8:9544276-9544298 CCTCTTCTACTGATTGGATGAGG + Intergenic
1037094592 8:14969296-14969318 CCTCTGCAACAGATAGGAGTAGG - Intronic
1038565853 8:28619541-28619563 CCTCTCCCACTGCTGCCAGTTGG + Intronic
1041128983 8:54676320-54676342 CCTCTCCTATTACTGGCAGTTGG - Intergenic
1041281690 8:56216615-56216637 CCTTTCCCACTGATGGCTGTAGG + Intronic
1041663943 8:60424507-60424529 CCCCTCCAAGTGATGGGAGGGGG - Intergenic
1042735071 8:71978844-71978866 CCTCTTGTACTGATGTGTGTGGG + Intronic
1042805862 8:72770037-72770059 ACTCTCCAATTGATGAGAGTTGG - Intronic
1048406354 8:134126580-134126602 CCTCTCCCACACCTGGGAGTGGG + Intergenic
1048746982 8:137625231-137625253 CCTCTCCTGCTGATTAGAGCTGG - Intergenic
1050795655 9:9537992-9538014 CCCCTACTACTTTTGGGAGTGGG + Intronic
1052465676 9:28826433-28826455 CCTGTACTTCTGCTGGGAGTTGG + Intergenic
1055446854 9:76393035-76393057 CCTCTCCTATTCATGTGAATAGG + Intronic
1058448094 9:105071566-105071588 CCTCTGCTCCTGTTAGGAGTGGG - Intergenic
1059391486 9:114002198-114002220 CCTGTCCTACTGATGAAAGTAGG - Intronic
1060214512 9:121730616-121730638 CCTCCCCTACAGATAGGTGTTGG - Intronic
1191737747 X:64405243-64405265 TCTTTCCTACTATTGGGAGTTGG + Intergenic
1195377972 X:104245857-104245879 GGACTCCTACTGATGGAAGTAGG - Intergenic
1195431608 X:104795715-104795737 CTACTCCTACTGCTGGGACTTGG + Intronic