ID: 967119042

View in Genome Browser
Species Human (GRCh38)
Location 3:186366282-186366304
Sequence TTTCTAAGAAAACTAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967119042_967119045 -10 Left 967119042 3:186366282-186366304 CCTCATTTTAGTTTTCTTAGAAA No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data
967119042_967119047 15 Left 967119042 3:186366282-186366304 CCTCATTTTAGTTTTCTTAGAAA No data
Right 967119047 3:186366320-186366342 ATGGTCCCTACAACCCTTTCTGG No data
967119042_967119046 -4 Left 967119042 3:186366282-186366304 CCTCATTTTAGTTTTCTTAGAAA No data
Right 967119046 3:186366301-186366323 GAAAATAAGGAGGCTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967119042 Original CRISPR TTTCTAAGAAAACTAAAATG AGG (reversed) Intergenic
No off target data available for this crispr