ID: 967119045

View in Genome Browser
Species Human (GRCh38)
Location 3:186366295-186366317
Sequence TTCTTAGAAAATAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967119037_967119045 19 Left 967119037 3:186366253-186366275 CCAGCCCTGGGAATGTAGGCAGG No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data
967119042_967119045 -10 Left 967119042 3:186366282-186366304 CCTCATTTTAGTTTTCTTAGAAA No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data
967119039_967119045 15 Left 967119039 3:186366257-186366279 CCCTGGGAATGTAGGCAGGAGAT No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data
967119041_967119045 -9 Left 967119041 3:186366281-186366303 CCCTCATTTTAGTTTTCTTAGAA No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data
967119040_967119045 14 Left 967119040 3:186366258-186366280 CCTGGGAATGTAGGCAGGAGATT No data
Right 967119045 3:186366295-186366317 TTCTTAGAAAATAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967119045 Original CRISPR TTCTTAGAAAATAAGGAGGC TGG Intergenic
No off target data available for this crispr