ID: 967119047

View in Genome Browser
Species Human (GRCh38)
Location 3:186366320-186366342
Sequence ATGGTCCCTACAACCCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967119041_967119047 16 Left 967119041 3:186366281-186366303 CCCTCATTTTAGTTTTCTTAGAA No data
Right 967119047 3:186366320-186366342 ATGGTCCCTACAACCCTTTCTGG No data
967119042_967119047 15 Left 967119042 3:186366282-186366304 CCTCATTTTAGTTTTCTTAGAAA No data
Right 967119047 3:186366320-186366342 ATGGTCCCTACAACCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967119047 Original CRISPR ATGGTCCCTACAACCCTTTC TGG Intergenic
No off target data available for this crispr