ID: 967122526

View in Genome Browser
Species Human (GRCh38)
Location 3:186395775-186395797
Sequence ACAGGTAACCAGTAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967122526_967122532 19 Left 967122526 3:186395775-186395797 CCCTGCATCTACTGGTTACCTGT No data
Right 967122532 3:186395817-186395839 TTCCAACCACTCACTGTACTGGG No data
967122526_967122535 28 Left 967122526 3:186395775-186395797 CCCTGCATCTACTGGTTACCTGT No data
Right 967122535 3:186395826-186395848 CTCACTGTACTGGGTCCCACAGG No data
967122526_967122531 18 Left 967122526 3:186395775-186395797 CCCTGCATCTACTGGTTACCTGT No data
Right 967122531 3:186395816-186395838 TTTCCAACCACTCACTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967122526 Original CRISPR ACAGGTAACCAGTAGATGCA GGG (reversed) Intergenic
No off target data available for this crispr