ID: 967127697

View in Genome Browser
Species Human (GRCh38)
Location 3:186439899-186439921
Sequence CAGTGGGACAGGAGGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967127697_967127710 7 Left 967127697 3:186439899-186439921 CCGCCTCCCCTCCTGTCCCACTG No data
Right 967127710 3:186439929-186439951 TTCAGGGGCAATAACAAGCGTGG No data
967127697_967127705 -10 Left 967127697 3:186439899-186439921 CCGCCTCCCCTCCTGTCCCACTG No data
Right 967127705 3:186439912-186439934 TGTCCCACTGGAAGGTCTTCAGG 0: 264
1: 465
2: 462
3: 333
4: 355
967127697_967127707 -8 Left 967127697 3:186439899-186439921 CCGCCTCCCCTCCTGTCCCACTG No data
Right 967127707 3:186439914-186439936 TCCCACTGGAAGGTCTTCAGGGG 0: 211
1: 375
2: 389
3: 303
4: 343
967127697_967127706 -9 Left 967127697 3:186439899-186439921 CCGCCTCCCCTCCTGTCCCACTG No data
Right 967127706 3:186439913-186439935 GTCCCACTGGAAGGTCTTCAGGG 0: 253
1: 453
2: 447
3: 354
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967127697 Original CRISPR CAGTGGGACAGGAGGGGAGG CGG (reversed) Intergenic
No off target data available for this crispr