ID: 967128502

View in Genome Browser
Species Human (GRCh38)
Location 3:186448252-186448274
Sequence CAGTAGTACTGATGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967128496_967128502 28 Left 967128496 3:186448201-186448223 CCATAAAGTTGGGAGTTATAGAA No data
Right 967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG No data
967128495_967128502 29 Left 967128495 3:186448200-186448222 CCCATAAAGTTGGGAGTTATAGA No data
Right 967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967128502 Original CRISPR CAGTAGTACTGATGGGAAGT GGG Intergenic
No off target data available for this crispr