ID: 967128784

View in Genome Browser
Species Human (GRCh38)
Location 3:186451574-186451596
Sequence TCGCCTACATCCACTCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967128783_967128784 -1 Left 967128783 3:186451552-186451574 CCTCATGACGTGGCAGCTGGAAT No data
Right 967128784 3:186451574-186451596 TCGCCTACATCCACTCATCAAGG No data
967128779_967128784 23 Left 967128779 3:186451528-186451550 CCTCTTCATGGGCAGCCTGGGTG No data
Right 967128784 3:186451574-186451596 TCGCCTACATCCACTCATCAAGG No data
967128781_967128784 8 Left 967128781 3:186451543-186451565 CCTGGGTGTCCTCATGACGTGGC No data
Right 967128784 3:186451574-186451596 TCGCCTACATCCACTCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967128784 Original CRISPR TCGCCTACATCCACTCATCA AGG Intergenic
No off target data available for this crispr