ID: 967129014

View in Genome Browser
Species Human (GRCh38)
Location 3:186453480-186453502
Sequence AAATTTCAACACATGAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967129014_967129019 9 Left 967129014 3:186453480-186453502 CCCCAATTCATGTGTTGAAATTT No data
Right 967129019 3:186453512-186453534 TGTGATGGTATTAAGAGGTTAGG No data
967129014_967129018 4 Left 967129014 3:186453480-186453502 CCCCAATTCATGTGTTGAAATTT No data
Right 967129018 3:186453507-186453529 GTCATTGTGATGGTATTAAGAGG No data
967129014_967129017 -6 Left 967129014 3:186453480-186453502 CCCCAATTCATGTGTTGAAATTT No data
Right 967129017 3:186453497-186453519 AAATTTAGTTGTCATTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967129014 Original CRISPR AAATTTCAACACATGAATTG GGG (reversed) Intergenic
No off target data available for this crispr