ID: 967131358

View in Genome Browser
Species Human (GRCh38)
Location 3:186473595-186473617
Sequence GGTCTCCACCAAGGAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967131345_967131358 29 Left 967131345 3:186473543-186473565 CCAAGCTGCCAGTGTGGTTAACT No data
Right 967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG No data
967131349_967131358 2 Left 967131349 3:186473570-186473592 CCCTAGCTCGGAGAAGACCCAGG No data
Right 967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG No data
967131347_967131358 21 Left 967131347 3:186473551-186473573 CCAGTGTGGTTAACTGGTACCCT No data
Right 967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG No data
967131351_967131358 1 Left 967131351 3:186473571-186473593 CCTAGCTCGGAGAAGACCCAGGT No data
Right 967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967131358 Original CRISPR GGTCTCCACCAAGGAGGCAC AGG Intergenic
No off target data available for this crispr