ID: 967132923

View in Genome Browser
Species Human (GRCh38)
Location 3:186489096-186489118
Sequence CTGGCTATGTGGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967132923_967132930 15 Left 967132923 3:186489096-186489118 CCCTCCTCATCCCACATAGCCAG No data
Right 967132930 3:186489134-186489156 GTTTGTCCCTGTGAAAATGATGG No data
967132923_967132932 21 Left 967132923 3:186489096-186489118 CCCTCCTCATCCCACATAGCCAG No data
Right 967132932 3:186489140-186489162 CCCTGTGAAAATGATGGCTCAGG No data
967132923_967132934 22 Left 967132923 3:186489096-186489118 CCCTCCTCATCCCACATAGCCAG No data
Right 967132934 3:186489141-186489163 CCTGTGAAAATGATGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967132923 Original CRISPR CTGGCTATGTGGGATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr