ID: 967134060

View in Genome Browser
Species Human (GRCh38)
Location 3:186497915-186497937
Sequence TGAGTCTGTGGTGGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967134060_967134070 25 Left 967134060 3:186497915-186497937 CCAGGCCAACCACCACAGACTCA No data
Right 967134070 3:186497963-186497985 TCTGGACCACCCTCAGCACTAGG No data
967134060_967134067 7 Left 967134060 3:186497915-186497937 CCAGGCCAACCACCACAGACTCA No data
Right 967134067 3:186497945-186497967 GACGCAGTGGCCCTGGACTCTGG No data
967134060_967134064 -6 Left 967134060 3:186497915-186497937 CCAGGCCAACCACCACAGACTCA No data
Right 967134064 3:186497932-186497954 GACTCAATATCCAGACGCAGTGG No data
967134060_967134065 0 Left 967134060 3:186497915-186497937 CCAGGCCAACCACCACAGACTCA No data
Right 967134065 3:186497938-186497960 ATATCCAGACGCAGTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967134060 Original CRISPR TGAGTCTGTGGTGGTTGGCC TGG (reversed) Intergenic