ID: 967134451

View in Genome Browser
Species Human (GRCh38)
Location 3:186501716-186501738
Sequence TCATCTCCATGCCCTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967134451_967134457 13 Left 967134451 3:186501716-186501738 CCTGCAGAAGGGCATGGAGATGA No data
Right 967134457 3:186501752-186501774 TCAGAACACCTCATGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967134451 Original CRISPR TCATCTCCATGCCCTTCTGC AGG (reversed) Intergenic