ID: 967137353

View in Genome Browser
Species Human (GRCh38)
Location 3:186523660-186523682
Sequence GACCCCAAAAAAAAAACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967137348_967137353 11 Left 967137348 3:186523626-186523648 CCTTCTGGCTGCCGCTGATGTCT No data
Right 967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG No data
967137347_967137353 15 Left 967137347 3:186523622-186523644 CCTTCCTTCTGGCTGCCGCTGAT No data
Right 967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG No data
967137349_967137353 0 Left 967137349 3:186523637-186523659 CCGCTGATGTCTGTGACCCCAGT No data
Right 967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967137353 Original CRISPR GACCCCAAAAAAAAAACCTC CGG Intergenic
No off target data available for this crispr