ID: 967138509

View in Genome Browser
Species Human (GRCh38)
Location 3:186532816-186532838
Sequence GGACCCTGGTTGAGTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967138509_967138518 9 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138518 3:186532848-186532870 CAAAGGGGCACACTGGTGCTGGG No data
967138509_967138516 2 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138516 3:186532841-186532863 AGACTCACAAAGGGGCACACTGG No data
967138509_967138512 -8 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138512 3:186532831-186532853 CAGGGTCCTGAGACTCACAAAGG No data
967138509_967138514 -6 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138514 3:186532833-186532855 GGGTCCTGAGACTCACAAAGGGG No data
967138509_967138520 17 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138520 3:186532856-186532878 CACACTGGTGCTGGGGAAACAGG No data
967138509_967138517 8 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138517 3:186532847-186532869 ACAAAGGGGCACACTGGTGCTGG No data
967138509_967138513 -7 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138513 3:186532832-186532854 AGGGTCCTGAGACTCACAAAGGG No data
967138509_967138519 10 Left 967138509 3:186532816-186532838 CCAGAACCACTCAACCAGGGTCC No data
Right 967138519 3:186532849-186532871 AAAGGGGCACACTGGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967138509 Original CRISPR GGACCCTGGTTGAGTGGTTC TGG (reversed) Intergenic
No off target data available for this crispr