ID: 967144780

View in Genome Browser
Species Human (GRCh38)
Location 3:186597444-186597466
Sequence CAGAGGAGTCCAGCCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967144777_967144780 -10 Left 967144777 3:186597431-186597453 CCCAGCTCCTACACAGAGGAGTC 0: 1
1: 0
2: 1
3: 12
4: 152
Right 967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 202
967144775_967144780 -4 Left 967144775 3:186597425-186597447 CCAGAGCCCAGCTCCTACACAGA 0: 1
1: 1
2: 0
3: 24
4: 288
Right 967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 202
967144773_967144780 6 Left 967144773 3:186597415-186597437 CCAGGGATACCCAGAGCCCAGCT 0: 1
1: 0
2: 4
3: 29
4: 286
Right 967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 202
967144774_967144780 -3 Left 967144774 3:186597424-186597446 CCCAGAGCCCAGCTCCTACACAG 0: 1
1: 0
2: 1
3: 33
4: 317
Right 967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967144780 Original CRISPR CAGAGGAGTCCAGCCAGTGC AGG Intergenic
900781626 1:4622458-4622480 CAGAGTTGTCCACCCAGTGTTGG + Intergenic
901550085 1:9989578-9989600 AAGAGGAGTCCAGCCAGGGACGG + Intergenic
901879642 1:12186173-12186195 CCGAGGGGTGCAGCCAGGGCAGG + Intronic
903069204 1:20718170-20718192 GAAAGGAGCCCAGCCAGGGCTGG - Intergenic
904875738 1:33653257-33653279 CATAGGTGTACAGACAGTGCCGG - Intronic
922076865 1:222253756-222253778 GAGAGGAGTCCAGCCAGGGATGG + Intergenic
922573685 1:226648102-226648124 GAGCTGAGTCCAGGCAGTGCCGG - Intronic
922846426 1:228688552-228688574 CAAGGGAGTCCACCCAGTGTGGG + Intergenic
922999078 1:229991111-229991133 CAGAGGAGACCAGAAAGGGCAGG + Intergenic
923790571 1:237107838-237107860 GGGAGGAGCCCAGCCTGTGCAGG - Intronic
1063127170 10:3145488-3145510 CAGAGCAGTCCAGCATGTGGGGG - Intronic
1063138578 10:3237695-3237717 CAGGTGCGGCCAGCCAGTGCGGG + Intergenic
1063759929 10:9062331-9062353 CAGCAGAGTCCATCCTGTGCAGG + Intergenic
1064317548 10:14272340-14272362 CAGAGGAGACCAGGTAGTCCAGG + Intronic
1067750224 10:48966721-48966743 CAGAGGAACCCAGCCACTGAAGG - Intronic
1067776963 10:49170902-49170924 CAGGGGACATCAGCCAGTGCTGG - Intronic
1069606522 10:69742224-69742246 CAGTGGAGCCTAGCCAGTGGAGG - Intergenic
1070566414 10:77606733-77606755 CAGAGGAGACCACCCAGTGATGG - Intronic
1071007290 10:80897169-80897191 CGGAGGAGTAAAGGCAGTGCAGG - Intergenic
1071343120 10:84666252-84666274 TAGAGCGGACCAGCCAGTGCTGG - Intergenic
1072744440 10:97929952-97929974 AAGAGGAGCCCAGGCTGTGCTGG + Intronic
1073330674 10:102668325-102668347 CAGGGGAGTCCAGCCCAAGCTGG + Intergenic
1074168053 10:110903556-110903578 AAGTGTAGCCCAGCCAGTGCTGG - Intronic
1074193797 10:111161634-111161656 CATGGGAGGCCAGACAGTGCAGG + Intergenic
1076766525 10:132637638-132637660 CAGAGGAGGACAGCCACAGCAGG - Intronic
1077734000 11:4769083-4769105 CAGAGTAGTCCATTCAGTGATGG - Exonic
1078597787 11:12703336-12703358 CAGGGGAGTCCAGCTAGGGGAGG - Intronic
1079537951 11:21537913-21537935 CAGAAGACTCAAGGCAGTGCTGG - Intronic
1080605984 11:33865104-33865126 CAGAGGTGCCCAGGTAGTGCTGG - Intronic
1083639593 11:64138291-64138313 GGGAGGAGACCAGGCAGTGCCGG - Intronic
1084947942 11:72648967-72648989 AAGATGACTCCAGCCAGTGTGGG - Intronic
1086856662 11:91873831-91873853 CAGAGGTGTCCAGCCAAGACTGG - Intergenic
1088935934 11:114400397-114400419 CAGATCAGTCCAGCCTGTGTCGG + Exonic
1088939583 11:114439730-114439752 CCGAGGAGTCGAGCCCGTCCTGG + Intronic
1093027823 12:14260670-14260692 CGGCTGAGTCCAGCCAGCGCTGG - Intergenic
1094498660 12:31004991-31005013 CACAGGGGTCCTGCCAGTCCTGG - Intergenic
1094843132 12:34350247-34350269 CTGAGGGGTCCAGCCACTCCGGG + Intergenic
1097292496 12:57930010-57930032 TAGAGGGGTCCAGCCAGAGGAGG - Intergenic
1098758345 12:74391757-74391779 CAGAGAAGTTCAGCCAGGGATGG - Intergenic
1101996629 12:109530193-109530215 CAAAGCAGTCTAGCCAGTCCAGG - Intronic
1102532744 12:113558759-113558781 CAGAGGAGTCCAGCAGGAGCTGG + Intergenic
1102532987 12:113560336-113560358 CAGAGGAGCCCAGCAGGAGCTGG - Intergenic
1103397409 12:120618798-120618820 CAGGGGCGTCCAGCCAGTGAGGG + Intergenic
1107164252 13:37266567-37266589 CAGAAGTGTCCAGAGAGTGCTGG + Intergenic
1108483937 13:50905982-50906004 CTGGGGAGTCCAGCCAGGACCGG + Intergenic
1110253881 13:73410166-73410188 GAGAGGAGCCCAGCCTGGGCAGG + Intergenic
1111034498 13:82655268-82655290 CAGAGATTTCCAGGCAGTGCTGG - Intergenic
1112396865 13:99041546-99041568 CAGAGGTGGACAGCTAGTGCAGG + Intronic
1114648082 14:24266783-24266805 CAGCGCAGGGCAGCCAGTGCAGG + Exonic
1115379767 14:32722665-32722687 GAGAGGAGTTCAGCCAGGGATGG + Intronic
1115656079 14:35445025-35445047 CACAGCAGTCCACCCATTGCAGG - Intergenic
1117073169 14:52074507-52074529 CAGAGGAGTCAAGACACTCCAGG - Intergenic
1118732247 14:68676697-68676719 CTGAGGAATCCAGCCAGGGAAGG + Intronic
1118852074 14:69591800-69591822 CAGAGGATTCTATCCAGGGCTGG + Intergenic
1121645269 14:95514212-95514234 CAGGGGACTCCAGCCTGGGCGGG - Intergenic
1122295283 14:100701987-100702009 CACAGGATGCCAGCTAGTGCAGG + Intergenic
1122438877 14:101716747-101716769 CTGAGGAGTGCACCCAGAGCTGG - Intergenic
1122716119 14:103698074-103698096 CAGAGGAGCGCAGGCAGCGCAGG - Exonic
1202856507 14_GL000225v1_random:54543-54565 CAGAGGAGGCGAGCCACTGGAGG - Intergenic
1123992685 15:25695202-25695224 CAGAGGTGTTGAGCCAGGGCGGG - Intronic
1124618781 15:31262211-31262233 CACAGGAGTCCAGGCAGAGGAGG + Intergenic
1125171150 15:36768120-36768142 CAGAGGAAGCCAGACAGTGTTGG + Intronic
1126810171 15:52394425-52394447 CAGAGCATTCCAACCACTGCTGG + Intronic
1128304086 15:66586752-66586774 CAGAGGAGTGCAGGGAGAGCAGG + Intronic
1129314942 15:74736295-74736317 CTGGGGTGTCCAGCCAGTGAGGG + Intergenic
1131567739 15:93502287-93502309 AGGAGGAGGCCAGCCAGTGGAGG + Intergenic
1131953892 15:97710732-97710754 GAGATGAGGCCAGACAGTGCAGG + Intergenic
1132403125 15:101526143-101526165 GAGAGGAGCGCAGCCAGGGCAGG - Intergenic
1132567581 16:630503-630525 CAGAGGAGGCCGGGCTGTGCTGG + Intronic
1136546440 16:30957675-30957697 GGGAGGAGGCCAGCCAGCGCTGG - Exonic
1137784424 16:51126160-51126182 CAGATGAGTCCAGCAGGGGCAGG - Intergenic
1138274015 16:55718023-55718045 CAGAGGAGTCTATCTAGTGGGGG - Intergenic
1138319688 16:56101560-56101582 CAGAGGACTCCAGCAAAAGCAGG + Intergenic
1138680035 16:58677730-58677752 CAGAGCAGCCCAGCCCGGGCAGG + Intronic
1141175126 16:81713658-81713680 CAGAGGAGCCCAGCTGCTGCGGG - Intergenic
1144188033 17:12814753-12814775 AAGAGGAGTACACCCAGTGGAGG - Intronic
1147165666 17:38591908-38591930 CAGAGAATTCCAGGCAGAGCGGG - Intronic
1148001492 17:44390111-44390133 CACAGCAGTGCAGTCAGTGCTGG + Intergenic
1148456204 17:47812874-47812896 CTGAGGAGCCCTGCCAGTGAAGG - Intronic
1150890965 17:69149405-69149427 CAGAGGAGTCCACTCCATGCTGG + Intronic
1152162066 17:78675002-78675024 CAGAGTAGTCCAGTTAGGGCTGG + Exonic
1152204982 17:78969849-78969871 CAGAGGCCTCCATCCAGTACAGG + Intergenic
1152425561 17:80216826-80216848 CACAGCAGTGCAGCCAGGGCTGG + Intronic
1153682266 18:7511878-7511900 CAGAACAATCCAGCCAGTGGTGG + Intergenic
1157582331 18:48780905-48780927 CAGAGGAGTCCAGGGAGAGAGGG - Intronic
1157725829 18:49962898-49962920 CAGAGGAGTCCCCCCAATCCTGG + Intronic
1159159947 18:64631395-64631417 CACAGGAGTCAGGCCAGGGCAGG - Intergenic
1160352305 18:78193943-78193965 CCGAGGAGTCCAGGCAGCACAGG + Intergenic
1160762308 19:791795-791817 CAGGGGAGTTCAGCTAGAGCTGG - Intergenic
1160985674 19:1837497-1837519 AGGAAAAGTCCAGCCAGTGCCGG + Intronic
1162246578 19:9406663-9406685 CAGGGGATTCCAGCCAGTTTGGG - Intergenic
1163127863 19:15254026-15254048 CAGAGGAACCCAGCAAGTTCTGG + Intronic
1163531802 19:17854269-17854291 CAGAGGAATCCTGCCAGGCCAGG + Intergenic
1164663512 19:30002437-30002459 CAAAGGATTTCAGCCAGTTCTGG + Intronic
1165093433 19:33398016-33398038 CAGGTGAGGCCAGCCAGGGCTGG + Intronic
1165419480 19:35715889-35715911 TCGAGGAGTCCAGCCTGAGCAGG + Intronic
1166134252 19:40765994-40766016 CAAATGAGTCCAGGCACTGCCGG - Intergenic
926109315 2:10171993-10172015 CAGAGGAGCCCTGCTAGTCCAGG + Intronic
928593541 2:32840098-32840120 CACTGGAGTCAAGCCAGTGCTGG - Intergenic
930861946 2:56083584-56083606 TAGAGGAAAACAGCCAGTGCTGG - Intergenic
931701591 2:64913512-64913534 CCCAGCAGGCCAGCCAGTGCTGG - Intergenic
932028194 2:68157018-68157040 CAGTGCAGTCCAGCCAAAGCGGG - Intronic
932208927 2:69910959-69910981 CACAGCACTCCAGCCAGAGCAGG - Intronic
932485821 2:72083835-72083857 GAGAGGAGACCAGCCTGAGCTGG + Intergenic
935114313 2:100121354-100121376 GAGAGGAGTCCGGCCAGGGATGG + Intronic
937343113 2:121104598-121104620 CAGAGGAGTTCAGTCAGGGGAGG + Intergenic
937470900 2:122173064-122173086 AAGAGAAGTCCAGCAAGTGAAGG + Intergenic
938409352 2:131051088-131051110 CAGAGAGGGCCAGGCAGTGCTGG - Exonic
938714986 2:134010974-134010996 GAGAGGAGGCCTGCAAGTGCAGG - Intergenic
942595937 2:177591961-177591983 CAGAGGATTCCATTCAGTCCCGG + Intergenic
946811371 2:223529439-223529461 CAGAGCAGTCCAGCAATTTCAGG + Intergenic
947693650 2:232163602-232163624 CAGAGGAGTTCAGCAAGAGAAGG + Exonic
947914116 2:233820709-233820731 CAGAGCAGTGGAGCCTGTGCTGG + Intronic
948206433 2:236164913-236164935 CGGAGGAGGCAAGCGAGTGCGGG - Intergenic
1169343339 20:4812259-4812281 TAAAGGAGTCCAGGCAGTGATGG - Intronic
1169400351 20:5274301-5274323 CACAGGAGTCCAGTGAGAGCTGG - Intergenic
1169571972 20:6916127-6916149 CAGAGGAGTCCAGAAAATTCGGG - Intergenic
1169781300 20:9313782-9313804 CTGAGAAGCCCAGCCAGTGGTGG - Intronic
1170838099 20:19902240-19902262 CGGAGGAGTCCAATGAGTGCTGG - Intronic
1171130815 20:22651735-22651757 CAGATGAGTCCAGCCCATCCTGG - Intergenic
1171346606 20:24470212-24470234 CGAAGGAGACCAGCCAGGGCTGG + Intronic
1172698033 20:36835665-36835687 CAGAGGTGTCCATCCAGCTCAGG + Intronic
1173603346 20:44311344-44311366 CAGAGGAGACGAGCGAGTTCGGG - Intergenic
1173993580 20:47321062-47321084 CAGAGGAGTCCAGCGTTTACTGG - Intronic
1174056361 20:47800908-47800930 CAGCTGAGTCCTGGCAGTGCAGG + Intergenic
1175946651 20:62562140-62562162 CAGAGAAGGCCAGGCAGGGCTGG + Intronic
1176023643 20:62975016-62975038 CAAAGGTGCCCAGGCAGTGCTGG - Intergenic
1176424964 21:6542910-6542932 CAGAGCTGTCCACCCAGGGCTGG - Intergenic
1179682671 21:43035319-43035341 TAGAGGAGAGCAGCCAGTGAAGG - Intergenic
1179700453 21:43151219-43151241 CAGAGCTGTCCACCCAGGGCTGG - Intergenic
1181372813 22:22431732-22431754 CAGAGGACACCAGGCAGGGCAGG - Intergenic
950128774 3:10527686-10527708 CTGAGGAGACCAACCAGTCCAGG + Intronic
950703648 3:14766994-14767016 CACAGGAGACCAGCGAGGGCCGG + Intronic
953421509 3:42756918-42756940 CAGAGGAGTCCTGGAAGTGAGGG - Intronic
954563530 3:51579027-51579049 GAGAGGAGTCCGGCCAGGGAAGG - Intronic
954752411 3:52821136-52821158 AAGAGGGGCCCAGCCAGGGCAGG + Intronic
955408406 3:58640335-58640357 CAGATGAGCCCAGCCATTCCTGG - Intronic
957717133 3:83942630-83942652 GAGAGGAGTCTAGCCAGGGATGG - Intergenic
959474262 3:106790352-106790374 CAGAGCACTCCAGCCAGTGGTGG - Intergenic
960206781 3:114911423-114911445 CAGAGCAGTCCTGCCAGCACAGG + Intronic
962857002 3:139356029-139356051 CAGAGAAGTTCTGACAGTGCAGG + Intronic
964535672 3:157718463-157718485 CAGAGGTGCCCAGCCAGTGATGG + Intergenic
966156391 3:176921024-176921046 CACAAGAGTCCAGGAAGTGCAGG + Intergenic
966225842 3:177597132-177597154 CAGGTGAGTCCATCCAGTTCTGG - Intergenic
966805514 3:183804614-183804636 CGGAGGACGCCACCCAGTGCGGG + Intronic
967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG + Intergenic
967925461 3:194642205-194642227 CAAAGGAGTCCAGGCTGTGATGG - Exonic
968460726 4:723568-723590 CAGAGGGTTCCAGACGGTGCGGG + Intronic
969411867 4:7033740-7033762 CAGAGGAGAGCAGCCACTGAGGG - Intergenic
969590361 4:8118528-8118550 CAGAGGGGTGCAGCTTGTGCTGG - Intronic
969631823 4:8343404-8343426 CAGAGAATTCCAGCCAGGGAGGG + Intergenic
972203940 4:36748102-36748124 CAGAGGAGGACAGCCAGAGCAGG + Intergenic
972249502 4:37284833-37284855 CAGAGGACTCTAGCCATTGAAGG - Intronic
972344649 4:38182743-38182765 CAGTGCAGACCAGCCCGTGCTGG + Intergenic
972404221 4:38731276-38731298 TAGAGGAGTCCAGAAAATGCGGG + Intergenic
972846360 4:42995831-42995853 TTGAGGAATCCAGCCAGTTCTGG + Intronic
978860803 4:113446655-113446677 CTGATGTGCCCAGCCAGTGCTGG - Intergenic
978886619 4:113772702-113772724 CTGAGGAGTGCAGGGAGTGCTGG + Intergenic
980930507 4:139178350-139178372 CAGAAGCGTGCAGCCACTGCTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
984531333 4:180920163-180920185 CTGTGGAGTCAAGACAGTGCTGG + Intergenic
985206715 4:187546025-187546047 CATAAGAGTTCAGCCATTGCAGG - Intergenic
992194706 5:74327763-74327785 ATGAGCAGTCCAGACAGTGCAGG - Intergenic
992910357 5:81390540-81390562 CACTGCACTCCAGCCAGTGCTGG - Intronic
997659056 5:135576177-135576199 CAGAGGAGTCCAGTCAAGGCAGG - Intronic
998129026 5:139641908-139641930 CACAGGAGGCCAGCCAGCTCAGG + Intergenic
998850970 5:146350259-146350281 CTGTGGACTCCAGCCAGAGCTGG - Intergenic
999123599 5:149229654-149229676 CTCAGGAATCCAGCCATTGCTGG + Intronic
1002461505 5:179376037-179376059 GGGAGGAGTCCAGCCAGAGGAGG + Intergenic
1003392934 6:5728956-5728978 AAGAGCACACCAGCCAGTGCTGG - Intronic
1006079675 6:31558151-31558173 CTGAGGGCTCCAGCCAGAGCTGG + Exonic
1006445183 6:34076117-34076139 CAGAGAAGAACAGACAGTGCAGG + Intronic
1007764733 6:44153883-44153905 GAGTGGATTCCAGCCAGAGCAGG + Intronic
1008861149 6:56151382-56151404 CAGAGGAGTACAGCTACTGAAGG - Intronic
1010120083 6:72365095-72365117 CAGAGGTGCCCAGCCAGTGAGGG + Intronic
1013033781 6:106360940-106360962 CCGGGGAGCCCAGCCCGTGCAGG + Intergenic
1014812421 6:125901905-125901927 CGGAGGAGTTCAGCCAGGTCTGG - Intronic
1015605375 6:134950106-134950128 CTCAGGAGTCCAGACAGTGGTGG - Exonic
1016183119 6:141171255-141171277 GAGAGGAGTCCTGCCAGGGATGG - Intergenic
1017239227 6:152148288-152148310 CAGAGCGGTCGTGCCAGTGCAGG + Exonic
1017784103 6:157740600-157740622 CAGAGCTCTCCAGCCAATGCTGG - Intronic
1018235211 6:161717215-161717237 GAGAGGAGGCCATCCAGTGCGGG + Intronic
1020379698 7:7529787-7529809 CAGAGGGCTCCAGCCCGTGTGGG - Intronic
1024685292 7:51737961-51737983 CAGAGGAGTGAAGCCTTTGCTGG - Intergenic
1028348977 7:89819684-89819706 GAGAGAAGCCCAGCCAGAGCTGG - Intergenic
1033725265 7:144109640-144109662 CAGAGGAGAATCGCCAGTGCTGG - Exonic
1034259555 7:149746272-149746294 TAGAGGAATCCAGCCAGGGGAGG - Intergenic
1034737460 7:153442125-153442147 CAGAAAGGTCCAGGCAGTGCAGG + Intergenic
1036613208 8:10367727-10367749 CAGTGGGGTCCAGCCAGCGCCGG - Intronic
1040553026 8:48453399-48453421 CAGGGGAATCCAGCCCATGCAGG + Intergenic
1041541485 8:58989994-58990016 CAGAGGAGCACAACCATTGCTGG - Intronic
1042225161 8:66509502-66509524 CAGAGAAGTCATGCCTGTGCTGG - Intronic
1042340716 8:67675877-67675899 CACAGCACTCCAGCCTGTGCTGG - Intronic
1042989767 8:74626159-74626181 CAGAGCAGAGCAGCAAGTGCTGG + Intronic
1044950047 8:97427204-97427226 CAGAGCAGTCCAGCCAGACTTGG + Intergenic
1048223544 8:132564609-132564631 CAGAGGCATCCACCCAGAGCTGG + Intergenic
1048413317 8:134198457-134198479 CAGAGTATACCAGCCAGGGCTGG + Intergenic
1048439591 8:134450251-134450273 GAGAGGAGTCCAGCCAGGGATGG + Intergenic
1049744848 8:144258941-144258963 CGGTGGAGCCCAGCCAGTGCTGG - Intronic
1055890417 9:81117832-81117854 CAAATGAGTCTAGCCAGTGAAGG - Intergenic
1056928871 9:90858151-90858173 TAGAGGAGTCCAGCCCTTCCAGG + Intronic
1056959044 9:91105700-91105722 CAGAGGACCCCAGCAAGTGGTGG + Intergenic
1057857762 9:98615101-98615123 CAGAGGTGGCCAGCCAGCCCAGG - Intronic
1058217523 9:102253815-102253837 CAGAGGAGGCCAGCCAGGAGAGG - Intergenic
1059322536 9:113480865-113480887 CAGAAGAGTCCTGGCAGTGGGGG - Intronic
1059411053 9:114132563-114132585 CACAGGTACCCAGCCAGTGCTGG - Intergenic
1060087635 9:120715709-120715731 CAGAGGAAGCCAGGCAGGGCGGG + Intergenic
1060509432 9:124221319-124221341 CAGAAGAGAGCAGCCTGTGCTGG - Intergenic
1060638705 9:125220651-125220673 GAGAGGTGCCCAGCCCGTGCAGG + Exonic
1062421701 9:136485533-136485555 CAGAGGCCTCCACCCAGTGCTGG + Exonic
1203773543 EBV:61046-61068 CGAAGGAGACCAGCCAGCGCAGG + Intergenic
1187384288 X:18833289-18833311 GAGAGGAGCCCAGCCAGAGACGG + Intergenic
1193438653 X:81512206-81512228 CAGAGGACTTCAGCCAGTTGTGG - Intergenic
1195773569 X:108378170-108378192 GAGTAGAGTCCAGGCAGTGCTGG - Intronic
1196182216 X:112704478-112704500 CAGAGCACTCCAGCCTGTGGTGG + Intergenic
1198101629 X:133427225-133427247 CAAAGGAGTCAAGCCAGTATTGG - Intergenic
1198562204 X:137863065-137863087 GAGAGAAGTCCAGCCAGAGGAGG + Intergenic
1200118997 X:153781640-153781662 GACAGGATCCCAGCCAGTGCTGG - Intronic
1201711126 Y:16993665-16993687 CTGAGCAGTTCAGCCACTGCAGG + Intergenic