ID: 967150281

View in Genome Browser
Species Human (GRCh38)
Location 3:186642205-186642227
Sequence CAGGAAGGTGAGCAGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 709}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967150281_967150287 16 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150287 3:186642244-186642266 ATACACAGTCACACGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 88
967150281_967150289 24 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150289 3:186642252-186642274 TCACACGTGTTGGGGAGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 222
967150281_967150285 14 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150285 3:186642242-186642264 TTATACACAGTCACACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 83
967150281_967150288 19 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180
967150281_967150286 15 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150286 3:186642243-186642265 TATACACAGTCACACGTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967150281 Original CRISPR CAGGAAGGTGAGCAGAAGTG AGG (reversed) Intronic