ID: 967150283

View in Genome Browser
Species Human (GRCh38)
Location 3:186642220-186642242
Sequence ATTGAGTTCTAACCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967150283_967150285 -1 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150285 3:186642242-186642264 TTATACACAGTCACACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 83
967150283_967150287 1 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150287 3:186642244-186642266 ATACACAGTCACACGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 88
967150283_967150286 0 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150286 3:186642243-186642265 TATACACAGTCACACGTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
967150283_967150289 9 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150289 3:186642252-186642274 TCACACGTGTTGGGGAGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 222
967150283_967150288 4 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967150283 Original CRISPR ATTGAGTTCTAACCACAGGA AGG (reversed) Intronic