ID: 967150284

View in Genome Browser
Species Human (GRCh38)
Location 3:186642224-186642246
Sequence TATAATTGAGTTCTAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967150284_967150286 -4 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150286 3:186642243-186642265 TATACACAGTCACACGTGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
967150284_967150287 -3 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150287 3:186642244-186642266 ATACACAGTCACACGTGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 88
967150284_967150288 0 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180
967150284_967150289 5 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150289 3:186642252-186642274 TCACACGTGTTGGGGAGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 222
967150284_967150285 -5 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150285 3:186642242-186642264 TTATACACAGTCACACGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 83
967150284_967150290 30 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150290 3:186642277-186642299 ACATATTCTAGCTGTGTCCTAGG 0: 1
1: 0
2: 0
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967150284 Original CRISPR TATAATTGAGTTCTAACCAC AGG (reversed) Intronic