ID: 967150288

View in Genome Browser
Species Human (GRCh38)
Location 3:186642247-186642269
Sequence CACAGTCACACGTGTTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967150283_967150288 4 Left 967150283 3:186642220-186642242 CCTTCCTGTGGTTAGAACTCAAT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180
967150284_967150288 0 Left 967150284 3:186642224-186642246 CCTGTGGTTAGAACTCAATTATA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180
967150281_967150288 19 Left 967150281 3:186642205-186642227 CCTCACTTCTGCTCACCTTCCTG 0: 1
1: 0
2: 3
3: 71
4: 709
Right 967150288 3:186642247-186642269 CACAGTCACACGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967150288 Original CRISPR CACAGTCACACGTGTTGGGG AGG Intronic