ID: 967153171

View in Genome Browser
Species Human (GRCh38)
Location 3:186668104-186668126
Sequence ATGTGTTGATGAGCCTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967153171_967153175 -10 Left 967153171 3:186668104-186668126 CCATGCCAGGCTCATCAACACAT 0: 1
1: 0
2: 1
3: 13
4: 213
Right 967153175 3:186668117-186668139 ATCAACACATGTTAGGGCATAGG 0: 1
1: 0
2: 0
3: 2
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967153171 Original CRISPR ATGTGTTGATGAGCCTGGCA TGG (reversed) Intronic
900083034 1:873491-873513 ATGTGTTTATGATCCTGTCTGGG - Intergenic
901192053 1:7418487-7418509 AAGTGTTGAGAAGCCAGGCACGG - Intronic
901861842 1:12079489-12079511 AGGAGCTGATGAGCCAGGCAGGG + Intronic
902296730 1:15472723-15472745 ATGTGTTGATTGGCCAGGCCTGG - Intronic
905700780 1:40011970-40011992 ATGTTTTGATTAGCCGGGCGTGG - Intergenic
906253590 1:44330557-44330579 ATGTATTGATGCTCCTGCCACGG - Intronic
907156249 1:52337025-52337047 ATGTGTTTATGTGTCTGGCTTGG + Intronic
907447479 1:54518068-54518090 AGGTGGTTATGAGCCTGGTAGGG + Intergenic
910934812 1:92479154-92479176 AAGTGTTGAAGGGCCAGGCACGG - Intronic
913101716 1:115573705-115573727 ATGTGGTGGTGAGCCTGCAAGGG + Intergenic
914691682 1:150034850-150034872 ATGTCATTATGAGCCAGGCACGG + Intergenic
914795765 1:150918942-150918964 ATGTGGTTGTGAGCCGGGCATGG + Intergenic
915263507 1:154697000-154697022 ATGGGTTGAGAAGCCTGGCTTGG + Intergenic
915426216 1:155829313-155829335 ATGTTATGATCAGCCAGGCATGG + Intronic
916030550 1:160874191-160874213 AATTGTTCATAAGCCTGGCATGG + Intergenic
916325044 1:163546921-163546943 ATGTGTTTATGTTACTGGCAGGG + Intergenic
916492748 1:165316268-165316290 ATGTGTTCATGGGGCTGGGAAGG - Intronic
916821712 1:168405064-168405086 ATAAGTTCATGAGCATGGCAAGG + Intergenic
917883451 1:179361877-179361899 ATGAGTTGATAGGCCAGGCATGG + Intergenic
917901423 1:179546801-179546823 ATGTGGTGAAGAGCCAGGCCTGG - Intronic
918130081 1:181619740-181619762 ATTTATTGATGAACCTGACATGG + Intronic
922448071 1:225714182-225714204 ATATTTTAATTAGCCTGGCATGG - Intergenic
922668794 1:227493810-227493832 ATGTGTTTATGATCCTGTCTGGG + Intergenic
922670802 1:227507489-227507511 ATGTGTTTATGATCCTGTCTGGG - Intergenic
923203880 1:231739434-231739456 ACGTGGTGATGAGCCTGCCAGGG - Intronic
923231333 1:231989212-231989234 ATCTGTTTATGAGCCTGACCTGG - Intronic
923695774 1:236249314-236249336 TTGTATTTATGAGCCGGGCATGG - Intronic
924243236 1:242059431-242059453 ATGTGTTTATGATCCTGTCTGGG - Intergenic
1062764022 10:47893-47915 ATGTGTTTATGATCCTGTCTGGG + Exonic
1064069242 10:12211816-12211838 ATGTATAGATGGGCCTGGCGCGG + Intronic
1065123610 10:22551717-22551739 GTATGTTGATGAACCTGGAATGG + Intronic
1065983507 10:30927136-30927158 CTGTGTGGATCAGGCTGGCAAGG - Intronic
1068205012 10:53838912-53838934 ATGAATTGATGAGCCAGGCACGG + Intronic
1068512712 10:57986364-57986386 ATGTGGTGATGAGTCAGACATGG + Intergenic
1069814275 10:71183776-71183798 ATGTCTTCATGACCCTAGCAAGG - Intergenic
1073688712 10:105784132-105784154 TGGGGTTGATGAGCCTGTCATGG + Intergenic
1073937663 10:108653216-108653238 ATGTGTGGCTGATCCTGGCAGGG + Intergenic
1074307463 10:112292293-112292315 ATGTCCTGATGAGAATGGCAGGG + Intronic
1074321018 10:112402382-112402404 ATGAGTTAATGTGCCTGGCATGG + Intronic
1074646140 10:115455268-115455290 ATGTGTTGTTGAACTTGGCTTGG + Intronic
1075411111 10:122228555-122228577 ATGTGTGGAAGACCGTGGCATGG - Intronic
1076851284 10:133094556-133094578 TTGTGTTGAAGAGCCTGGGGTGG - Intronic
1077489753 11:2855338-2855360 GAGTGTTGATGGGCCTGGCCTGG + Intergenic
1079478212 11:20853932-20853954 ATTTTTTGTTGATCCTGGCAGGG + Intronic
1079904023 11:26222803-26222825 ATGTGGGGATGAGCCTCTCAGGG + Intergenic
1081203763 11:40250447-40250469 ATTTAATGATAAGCCTGGCATGG + Intronic
1082927470 11:58565144-58565166 ATGTGTTTATTGGCCAGGCATGG + Intronic
1083526819 11:63375074-63375096 ATGAATGGATGAGCCTGACAGGG - Intronic
1084007268 11:66330001-66330023 AGGTCATGCTGAGCCTGGCAAGG + Intergenic
1084464577 11:69314599-69314621 ATTTGTTACTGTGCCTGGCATGG + Intronic
1085018435 11:73190351-73190373 ATGAGCTGATAAGGCTGGCAGGG + Intergenic
1086173230 11:83859978-83860000 ATGTGGTGTTGAGCCTGTGATGG + Intronic
1086637767 11:89110933-89110955 ATGTGTTGATTGGCCGGGCGCGG - Intergenic
1088897208 11:114087632-114087654 GTGGGGTGATGAGCCTTGCAGGG - Intronic
1089696701 11:120220309-120220331 GAGTGCTGATGAGGCTGGCAAGG - Intronic
1089788389 11:120924332-120924354 CTGTGGTGAGGAGCCTGGAAGGG - Intronic
1091216355 11:133904760-133904782 AGGTGTTGGTGAGGCTGGAAGGG - Intergenic
1091344197 11:134842043-134842065 AAGTGCTGCTTAGCCTGGCATGG - Intergenic
1093924784 12:24898804-24898826 AGGTGTTGACAGGCCTGGCATGG - Intronic
1094498008 12:31001302-31001324 ATGTGTTAGTTAACCTGGCAAGG - Intergenic
1095791830 12:46176028-46176050 ATTTTTTAATTAGCCTGGCATGG - Intergenic
1096253137 12:50046192-50046214 ATGTGTTTATGGAACTGGCAGGG - Intergenic
1096441795 12:51649546-51649568 ATGTGGTGTTGAGCCTGCGAGGG - Intronic
1096463195 12:51834215-51834237 ATGTGATGGTGAGGGTGGCAAGG + Intergenic
1097177086 12:57149517-57149539 ATGTGTTTTAGAGCCCGGCAAGG + Intronic
1102950209 12:117026252-117026274 AAGTGTTGGTGGACCTGGCATGG - Intronic
1102950236 12:117026349-117026371 AAGTGTTGGTGGACCTGGCATGG - Intronic
1102950262 12:117026446-117026468 AAGTGTTGGTGGACCTGGCATGG - Intronic
1103075430 12:117978728-117978750 GTGTGTGGATGGGCCTGGCCTGG + Intergenic
1104514874 12:129415796-129415818 ATGCATTGATCAGACTGGCATGG + Intronic
1106585580 13:31053824-31053846 ATGTGTTGAGGTGTCTGCCAGGG - Intergenic
1107808972 13:44181028-44181050 CCCTGTTGAAGAGCCTGGCAGGG - Intergenic
1107937777 13:45359575-45359597 AAGTGTTTATGAACCTGGCCTGG + Intergenic
1108760613 13:53559073-53559095 ATGTGTTGATTAACATGTCAAGG - Intergenic
1110491142 13:76109460-76109482 ATGAGTTCATGTGCTTGGCACGG - Intergenic
1111144401 13:84161545-84161567 ATGAGTTCATGAGCTTTGCAGGG - Intergenic
1113108993 13:106801998-106802020 ATGTATTTATGTGCCTGGTATGG + Intergenic
1117443543 14:55781626-55781648 GCTTCTTGATGAGCCTGGCATGG - Intergenic
1118333742 14:64834315-64834337 ATGTGTGGTTGAGCGTGGCACGG - Intronic
1120048652 14:79839005-79839027 ATGTTCTGATGAGCTGGGCAAGG + Intronic
1121027356 14:90626423-90626445 ATGTGTGGAGGACCCGGGCAGGG - Intronic
1121329773 14:93042608-93042630 ATGTCCTGATGGGCCTGACAGGG + Intronic
1121348081 14:93150800-93150822 AGGTGTTAATGAGGCAGGCAGGG + Intergenic
1122326947 14:100887461-100887483 ATCTCTTAATGAGCCAGGCACGG + Intergenic
1122368653 14:101214713-101214735 ATGTGGAGATGGGCCGGGCACGG + Intergenic
1124622899 15:31287625-31287647 ATTAATTGATGAGCCTTGCAGGG - Intergenic
1126167343 15:45664977-45664999 CTGTGTTCAGGAGACTGGCAAGG - Intronic
1126623443 15:50663414-50663436 AAGTGTTTATGGGCCGGGCACGG - Intronic
1128034378 15:64510861-64510883 ATGTTTTGATGAGCCAGACCTGG + Intronic
1128395517 15:67221472-67221494 AAGGGTGGATGATCCTGGCAAGG + Intronic
1130553455 15:84906476-84906498 ATGTTTTAATTAGCTTGGCATGG - Intronic
1131271514 15:90950213-90950235 AGGTGATGGTGAGCTTGGCAAGG - Exonic
1132824276 16:1895431-1895453 ATGAGTTGATGTTCCTGGGACGG - Intergenic
1134127355 16:11625416-11625438 ATGCGTAAATGAGCCTGGCATGG - Intronic
1134237519 16:12478933-12478955 ATGTGTTCAATAGCTTGGCAGGG + Intronic
1136509434 16:30727127-30727149 AAGTGATGATGTGCCAGGCATGG - Intronic
1137754592 16:50891422-50891444 GTGTGTTGGTGAGCCAGGCCAGG + Intergenic
1140735136 16:77891722-77891744 ATGTGATGCTGAGCTTGACAGGG + Intronic
1142700513 17:1657353-1657375 ATGCGTTGCTGGGCCGGGCACGG + Intronic
1143281079 17:5754613-5754635 AGGTGAGGAAGAGCCTGGCAGGG - Intergenic
1144759464 17:17699231-17699253 ATGTCTTGAGGGCCCTGGCAGGG - Intronic
1146327057 17:31895822-31895844 ATGGATTGATGGGCCGGGCACGG - Intronic
1149268563 17:54953442-54953464 TTGTTTTGAGGAGCCAGGCAGGG + Intronic
1149909394 17:60553123-60553145 GGGTGATGATGAACCTGGCAAGG + Intergenic
1150417990 17:65002926-65002948 CTGTGTTGCCCAGCCTGGCAGGG - Intergenic
1151789110 17:76292716-76292738 TGGTGTAGATCAGCCTGGCATGG - Exonic
1152956930 18:48226-48248 ATGTGTTTATGATCCTGTCTGGG + Exonic
1153799704 18:8658474-8658496 ATGTTTTAATTAGCCAGGCATGG + Intergenic
1156261685 18:35450333-35450355 AGGTGGTGATGAGCCCGTCATGG + Intronic
1158496339 18:57958454-57958476 AAGTGTTTATGGGCCAGGCACGG + Intergenic
1159630733 18:70746507-70746529 ATGTTGTGATGAGCCTTACATGG + Intergenic
1160625240 18:80199933-80199955 ATCTGTTGCTCAGCCAGGCATGG - Intronic
1161582574 19:5088757-5088779 ATGTGCGGATGAAGCTGGCAGGG - Intronic
1162556612 19:11390510-11390532 ATGTGCTGATTAGCCAGGCCTGG - Intronic
1163433071 19:17279823-17279845 ATGTTCTGATGAGCCAGGCCTGG + Intronic
1164151853 19:22560664-22560686 ATGAGTTCATGACCTTGGCAGGG - Intergenic
1166068521 19:40374428-40374450 TTGTGACGATGACCCTGGCAGGG + Intronic
1166195392 19:41202497-41202519 AAGTATGGATGAGCCAGGCATGG + Intronic
925084935 2:1100540-1100562 CGGTGTTGACGAGCTTGGCAGGG + Intronic
925775035 2:7326717-7326739 ATGCATTGATGATCCTGCCAAGG + Intergenic
926206475 2:10837537-10837559 ATGAGTTGATGATACTTGCACGG - Intronic
931519706 2:63082306-63082328 ATTTGGTGAGGAGCCAGGCATGG - Intergenic
931580148 2:63763211-63763233 ATTTGTTGATGGTCCGGGCACGG + Intronic
932104156 2:68927665-68927687 ATTTTTTTATTAGCCTGGCATGG - Intergenic
932852779 2:75202102-75202124 ATGTGTTGATGAGTCTGACTTGG + Intergenic
935386153 2:102501874-102501896 AGGCGTGGGTGAGCCTGGCAGGG + Intronic
936293649 2:111248446-111248468 GTGAGTTGATCACCCTGGCAGGG - Intergenic
938823167 2:134978808-134978830 ATGTATTGAAGGGCCTGGGATGG - Intronic
939468110 2:142584448-142584470 ATGTGTATATTAGCCTGGAAGGG + Intergenic
939689696 2:145242342-145242364 ATGTATTTATCAGCCAGGCATGG - Intergenic
946071241 2:217036002-217036024 ATGTGTTGCTGAGTCAGGAATGG + Intergenic
948103826 2:235396884-235396906 ATGTGCTGAGCAGCCTGGCTTGG + Intergenic
948667269 2:239544551-239544573 ATGTGATGCTGAGCCCAGCAGGG + Intergenic
1169189984 20:3652470-3652492 ATGTTTTGCTCCGCCTGGCAGGG - Intergenic
1169487033 20:6042333-6042355 ACGCGTTGATGGGCTTGGCAGGG - Intronic
1170952531 20:20950003-20950025 ATGGTCTGATCAGCCTGGCAAGG - Intergenic
1172227939 20:33317601-33317623 AGGTGCTGGTGAGCCTGGCGTGG - Intergenic
1172459117 20:35102136-35102158 ATTTTTTAATTAGCCTGGCATGG + Intergenic
1173532422 20:43780612-43780634 ACGTGTTTAGGATCCTGGCAAGG - Intergenic
1173627129 20:44481260-44481282 ATGAGCTGCTGCGCCTGGCAGGG - Intronic
1174824467 20:53756909-53756931 ATGTGATTATCAGCCGGGCATGG + Intergenic
1174958090 20:55123472-55123494 ATGTGTTCATCACCCTGTCAAGG - Intergenic
1176744329 21:10638273-10638295 ATGAGTTGATGCGCCTGGCCAGG - Intergenic
1180658078 22:17441238-17441260 ATGTGTTAATAGGCCAGGCATGG - Intronic
1181360549 22:22330896-22330918 CTGTGTTGATGAGTCTTTCAAGG - Intergenic
1184628017 22:45753022-45753044 ATAAGTTGATCAGCCGGGCACGG - Intronic
1184852817 22:47130411-47130433 CTGTGTGAATGAGCCTGGCAGGG + Intronic
950479563 3:13236084-13236106 AAAGGTTGGTGAGCCTGGCACGG - Intergenic
951205695 3:19923939-19923961 ATGTACTGATGAGCTGGGCATGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954957470 3:54534455-54534477 ATGTGCTGATGAGCTTCACATGG - Intronic
956746573 3:72315574-72315596 ATGAGGTGGTGAGCATGGCAGGG - Intergenic
958418017 3:93899603-93899625 ATGTGTTGCGGGGGCTGGCAGGG + Intronic
959697181 3:109261250-109261272 ATGTGAGAATGAGCCAGGCACGG + Intergenic
964303821 3:155319288-155319310 ATTTGGTGAGGAGGCTGGCATGG - Intergenic
967153171 3:186668104-186668126 ATGTGTTGATGAGCCTGGCATGG - Intronic
967155304 3:186686203-186686225 ATGTGTCAACGAGCCTGGAATGG - Intergenic
967259459 3:187627646-187627668 ATGTGTAAATAAGCCAGGCAAGG + Intergenic
967843773 3:194028715-194028737 ATGTTTTGATGAACCAGGCCTGG + Intergenic
968357382 3:198119921-198119943 ATGTGTTTATGATCCTGTCTGGG - Intergenic
974478569 4:62416136-62416158 ATGCAATGATGAGCCTAGCATGG + Intergenic
977573336 4:98652617-98652639 AGGTGTTGAAGAGCATGTCAAGG - Intronic
979841993 4:125453416-125453438 ATGTGTTATTGGGCCAGGCAAGG + Intronic
980447526 4:132930458-132930480 ATGCCTTGATGGGCCTGGCATGG + Intergenic
984906182 4:184628215-184628237 ATGTGTGGATGATGCTGCCAGGG - Exonic
986076757 5:4345666-4345688 ATGTGTGGATGAGACTAGGAGGG - Intergenic
987052678 5:14161193-14161215 ATGTGTGTTTGAGCCAGGCATGG - Intronic
989111894 5:37914536-37914558 TTGTGTTGGTCAGCCTGGCCTGG + Intergenic
992424340 5:76640656-76640678 ATGTATGGATGATGCTGGCAAGG - Intronic
993661872 5:90647559-90647581 ATCTGTTGATGTGACTTGCATGG + Exonic
995438111 5:112160402-112160424 AGGTGTGGGTGAGCCAGGCAAGG - Intronic
999450902 5:151677406-151677428 AAGGGATGATGAGCCTGACAGGG - Intronic
1001526891 5:172435576-172435598 ATTTGTTTATTAGCCAGGCATGG - Intronic
1001666877 5:173440610-173440632 ATGAGGTGATAACCCTGGCAGGG + Intergenic
1003003817 6:2362071-2362093 ACATGTTGGTGAGCTTGGCATGG - Intergenic
1003686193 6:8305064-8305086 ATGTGCTGAAGAGGCTGGCGAGG + Intergenic
1004101467 6:12616494-12616516 ATGCCTTTATGGGCCTGGCACGG - Intergenic
1004265079 6:14142225-14142247 ATGTGGTGATGAGCCTGCTGGGG - Intergenic
1006121489 6:31809260-31809282 ATGAGTTCATGGGCCGGGCACGG + Intergenic
1006130647 6:31867233-31867255 ATTTTTTGATTAGCCAGGCATGG - Intronic
1007173077 6:39878194-39878216 TCTCGTTGATGAGCCTGGCAGGG - Exonic
1007603116 6:43096190-43096212 AGGTGTTGATCAGGCTGACAGGG + Intronic
1008282799 6:49616191-49616213 ATGTATTGCTCAGCCTGGCCTGG + Intronic
1008609987 6:53176798-53176820 AAGTGTTTATTAGCCAGGCATGG + Intergenic
1008637500 6:53425548-53425570 ATGTGGGGCTGGGCCTGGCACGG - Intergenic
1009299514 6:61997069-61997091 ATGTGTGGATGGGCTGGGCATGG - Intronic
1014992222 6:128094962-128094984 ATGTGTTAGTGAGCATGACAGGG + Intronic
1015088348 6:129324109-129324131 AAGTGTTGAGGAACATGGCATGG + Intronic
1015185369 6:130409424-130409446 TTGTGTAGAGCAGCCTGGCATGG - Intronic
1016614754 6:146033156-146033178 ATGTTAAGATGAGCCTGTCAAGG + Intronic
1016688411 6:146907509-146907531 ATGTGTTGATTGGCCAGGCATGG - Intergenic
1017413753 6:154197636-154197658 ATGTGCTGTAGAGCCTGGCTGGG - Intronic
1018625302 6:165771961-165771983 AAGTGCTGATGAGCCTGCCAAGG - Intronic
1020692181 7:11369150-11369172 ATGTTTTGATTAGCCTGGATTGG + Intergenic
1027059083 7:75071144-75071166 ATGTGTTCTTGGGCCAGGCACGG - Intronic
1027412677 7:77938438-77938460 ATGTGTTGATTGGCCGGGCGCGG + Intronic
1027682972 7:81243191-81243213 ATGTTTTCATCAGCCTGGCGCGG + Intergenic
1029220004 7:98981109-98981131 ATGTGCTGATTGGCCAGGCACGG + Intronic
1031666673 7:124492854-124492876 ATGAGTTCATGACCCTTGCAGGG + Intergenic
1033227559 7:139573384-139573406 ATGTGCTGCTGAGCCTGGGGAGG + Exonic
1035601820 8:901786-901808 GCTTGTTGATGAGCCTGGGAGGG - Intergenic
1037316702 8:17606004-17606026 ATGACATGATGAGCCTGGCTGGG - Intronic
1039110881 8:34039692-34039714 AAGTGTTGATGTGACTGGAAGGG - Intergenic
1039705452 8:40002074-40002096 ATGTATTTATGGGCCAGGCATGG - Intronic
1041040067 8:53837900-53837922 ATGTGTTGATGGGCTGGACATGG + Intronic
1041390108 8:57340189-57340211 AAGTGTTGATGAGGATGGGAGGG + Intergenic
1042166953 8:65955155-65955177 ATGTATTTATGGGCCAGGCATGG + Intergenic
1043844043 8:85143481-85143503 ATGTGTTAATTAGCCTGGCATGG + Intronic
1044558563 8:93590589-93590611 CAGTGTGGAGGAGCCTGGCAAGG - Intergenic
1045040498 8:98219382-98219404 AAGTGCTCAAGAGCCTGGCATGG + Intronic
1053138944 9:35670044-35670066 ATGTGGTGTTGGGCCAGGCATGG + Intronic
1055751776 9:79514475-79514497 ATGTGTTATTTGGCCTGGCATGG + Intergenic
1055773376 9:79741043-79741065 ATCTGTTGATGAGCATATCATGG + Intergenic
1058122430 9:101153871-101153893 AGGTATTGATGGGCCAGGCACGG - Intronic
1060122420 9:121006032-121006054 ATGTGTTGCTGATACTGTCAAGG - Exonic
1060495346 9:124114383-124114405 ATGTGTTTATGAGCCAGTCTGGG + Intergenic
1062120100 9:134829645-134829667 ATGTGAGGATGAGCCTGGCCGGG - Intronic
1062420588 9:136479640-136479662 ATGTGTGGATTGGCCAGGCACGG - Intronic
1062741236 9:138176406-138176428 ATGTGTTTATGATCCTGTCTGGG - Intergenic
1188853486 X:35161676-35161698 CGATGTTGATCAGCCTGGCACGG - Intergenic
1189245369 X:39559238-39559260 ATGAGTACATGAGCCGGGCATGG - Intergenic
1191208599 X:57860817-57860839 ATGAGTTCATGAGCTTTGCAGGG + Intergenic
1193115534 X:77772002-77772024 AAGTGTTTATCAGCCAGGCATGG + Intronic
1193531328 X:82658088-82658110 ATGTGGTTATGAGCTTGGGAAGG - Intergenic
1194422612 X:93695541-93695563 ATGTCTTCAGGGGCCTGGCATGG - Intronic
1197087202 X:122492784-122492806 ATGTGTTCATGACCTTTGCAGGG - Intergenic
1199292355 X:146119257-146119279 GTGTGAGGCTGAGCCTGGCAGGG + Intergenic
1200747558 Y:6915853-6915875 CTGTGATGATGAGCCAGGCCCGG - Intronic