ID: 967158797

View in Genome Browser
Species Human (GRCh38)
Location 3:186717578-186717600
Sequence GCTGCTACTAAGTTTAACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967158792_967158797 -1 Left 967158792 3:186717556-186717578 CCATCCTTTTCCTCTGCTCCAGG 0: 1
1: 0
2: 7
3: 79
4: 651
Right 967158797 3:186717578-186717600 GCTGCTACTAAGTTTAACCCAGG 0: 1
1: 0
2: 0
3: 8
4: 45
967158794_967158797 -5 Left 967158794 3:186717560-186717582 CCTTTTCCTCTGCTCCAGGCTGC 0: 1
1: 3
2: 6
3: 80
4: 643
Right 967158797 3:186717578-186717600 GCTGCTACTAAGTTTAACCCAGG 0: 1
1: 0
2: 0
3: 8
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967158797 Original CRISPR GCTGCTACTAAGTTTAACCC AGG Exonic
913386377 1:118262194-118262216 GCTGCTACTCAGTGTCAGCCAGG - Intergenic
916284156 1:163085953-163085975 GCTGCCATTAAGTTTATCTCTGG + Intergenic
916935084 1:169619376-169619398 CCTGCTTCTAAGTTCTACCCTGG + Intronic
922796509 1:228342221-228342243 GCTGGTACAAAGGTAAACCCCGG + Exonic
924424273 1:243936318-243936340 GGTGCTACAGAGTTTAACTCTGG + Intergenic
1069592721 10:69652064-69652086 GCTGCTAATCAGCTTGACCCAGG - Intergenic
1074567496 10:114594230-114594252 GCTGCTGCTTAGTTTCACTCTGG - Intronic
1080647903 11:34200103-34200125 GCTGCTAATAAGTTGAAACCTGG + Intronic
1093449720 12:19301402-19301424 GCTACTACTATGTTTATCCCTGG - Intronic
1096234194 12:49914705-49914727 CCTGGTACTGAGTTTAACCTGGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1106388084 13:29307596-29307618 GCTGGTACTCAGTGTAGCCCAGG - Intronic
1121275722 14:92666367-92666389 GCTGATACTAGGTTTAATCCTGG - Intronic
1121963578 14:98283683-98283705 GCTGCTATGGAGTTAAACCCAGG - Intergenic
1123099067 14:105783466-105783488 GCTGCTGCTCAGCTTAAGCCAGG + Intergenic
1124895922 15:33777488-33777510 GCTGTTAAAAAGTTAAACCCAGG - Intronic
1128742378 15:70092889-70092911 GCTGCTATAAATTTTAAACCTGG + Intronic
1132441716 15:101872622-101872644 GATGCTACTGAGTTTGACTCTGG - Intergenic
1133919846 16:10142255-10142277 GCTGCAGCTAACCTTAACCCTGG - Intronic
1136099235 16:27981195-27981217 GCTGGTTCAAAGTTTGACCCTGG + Intronic
1141633264 16:85300689-85300711 GCTGCTCCAAAGTGGAACCCTGG - Intergenic
1143972887 17:10808310-10808332 GCTGCTACCAAGTGAAGCCCAGG - Intergenic
1144552381 17:16252463-16252485 GCTGCTACTTAGTTGGAGCCAGG + Intronic
1144616002 17:16773496-16773518 GCTGCTACTAAATATGAACCTGG + Intronic
1144896703 17:18542166-18542188 GCTGCTACTAAATATGAACCTGG - Intergenic
1145135514 17:20402055-20402077 GCTGCTACTAAATATGAACCTGG + Intergenic
1154019512 18:10650476-10650498 GCTGCTGGGAAGTTTGACCCGGG + Intergenic
1159951395 18:74486792-74486814 GCTGCTTGAAAGTCTAACCCAGG + Intergenic
1166275612 19:41751537-41751559 ACTGCCACCAAGTTTGACCCTGG - Intronic
929112009 2:38413004-38413026 GCTGCTACTACTTTTATCCCAGG + Intergenic
934083585 2:88490407-88490429 GGTGCTACCAAATATAACCCAGG + Intergenic
935405140 2:102700958-102700980 GCTGCTACTAAGTATTTTCCTGG + Intronic
937565141 2:123276439-123276461 GAAGATACTAAGTTTATCCCGGG - Intergenic
940831520 2:158471374-158471396 TCTGATACTAAATTTAATCCAGG - Intronic
1173008970 20:39163936-39163958 GCTGCTACTAACTTTAACAGTGG - Intergenic
953604010 3:44396643-44396665 GCTTCTACTGAATTTAATCCTGG + Intronic
956210849 3:66799743-66799765 GCTGCCAGGAAGTTGAACCCTGG + Intergenic
966946869 3:184783102-184783124 GCTGTTTCTAAGTTTCTCCCAGG + Intergenic
967158797 3:186717578-186717600 GCTGCTACTAAGTTTAACCCAGG + Exonic
974907872 4:68079501-68079523 ACTGCTTCTAAGTTTAACAGGGG + Intronic
1002733657 5:181363945-181363967 GATGCTACTGAGTTTGACTCTGG - Intergenic
1005273295 6:24189299-24189321 GCAGTTACTAAGGTTAACTCAGG + Intronic
1013597616 6:111674269-111674291 GCTGCTACTTACATTAATCCTGG + Intronic
1026281928 7:68929624-68929646 TCTGCTTCAAAGTTTAACTCAGG - Intergenic
1026793683 7:73351772-73351794 ACAGCTACTAAGTTCAATCCTGG + Intronic
1027564881 7:79779342-79779364 GCTGGGACTAATTTTAACCCAGG - Intergenic
1035509864 8:170343-170365 GATGCTACTGAGTTTGACTCTGG + Intergenic
1043078232 8:75729659-75729681 GCTGCTACTAAGCTTCAGCCAGG - Intergenic
1048418125 8:134249761-134249783 GGTGGTACTAAGTTTAACTGTGG + Intergenic
1055488957 9:76784757-76784779 TGTGCTAGTAAGTATAACCCTGG - Intronic
1058611848 9:106786212-106786234 GCTGCTATCAACTTTGACCCTGG + Intergenic
1058966072 9:110039679-110039701 GCTGCTACTATGTTTGACTTCGG - Intronic
1061844067 9:133376683-133376705 GCAGCTCCTAGGTTGAACCCGGG + Intronic
1196991872 X:121338541-121338563 ACTACTACTAAGATTAACCCTGG + Intergenic