ID: 967159752

View in Genome Browser
Species Human (GRCh38)
Location 3:186725217-186725239
Sequence TTCATTAAGCATGAAGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967159752_967159757 -1 Left 967159752 3:186725217-186725239 CCTCCCTCTTCATGCTTAATGAA 0: 1
1: 0
2: 0
3: 8
4: 199
Right 967159757 3:186725239-186725261 AGTAAAACGGGCCCAAAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967159752 Original CRISPR TTCATTAAGCATGAAGAGGG AGG (reversed) Exonic
901347940 1:8563948-8563970 CTAATTAAGCATACAGAGGGGGG + Intronic
902212769 1:14915595-14915617 TTCATTCTTCATAAAGAGGGGGG - Intronic
904356149 1:29941278-29941300 TTCATGAGCCAGGAAGAGGGAGG + Intergenic
904410565 1:30322405-30322427 GTCATTAAACAGGCAGAGGGTGG - Intergenic
905166937 1:36088500-36088522 TCCCTTAAGCATCAGGAGGGCGG - Intergenic
906457486 1:46009505-46009527 GACAATAAGCATGAAGAAGGAGG + Intronic
906901818 1:49843957-49843979 TTCATTAAGCATGTATATTGAGG + Intronic
910255729 1:85245549-85245571 TACATTAAGCTGGAGGAGGGAGG - Intergenic
910268058 1:85361642-85361664 TGCATGTAGCATGAAAAGGGAGG - Intronic
910331842 1:86082320-86082342 TTCATGAATCATGAAGTGTGAGG - Intronic
910569084 1:88680329-88680351 TTTCTTAAGGAAGAAGAGGGTGG + Intergenic
911419997 1:97628932-97628954 TTTATTTAGCATGTAGAGGCTGG - Intronic
913567997 1:120092093-120092115 TTCATCAAGCAATAAGAGAGAGG + Intergenic
914288804 1:146253114-146253136 TTCATCAAGCAATAAGAGAGAGG + Intergenic
914411393 1:147431689-147431711 TTCATACAGCAGGAAGTGGGAGG + Intergenic
914549839 1:148703858-148703880 TTCATCAAGCAATAAGAGAGAGG + Intergenic
914616900 1:149368170-149368192 TTCATCAAGCAATAAGAGAGAGG - Intergenic
915832177 1:159141448-159141470 TACAGAAAGAATGAAGAGGGAGG + Intronic
915838974 1:159200605-159200627 TTCATTATTCATGAAGGGTGTGG + Intronic
916469745 1:165111674-165111696 TTCATTAAGCATCTAGATTGGGG - Intergenic
916966367 1:169947119-169947141 TTCATTAATACTGAAGAAGGTGG + Intronic
917703080 1:177600879-177600901 TTCATTAAGCCTGCAGAAAGAGG - Intergenic
919077456 1:192830864-192830886 TTCATGAAGAAGGAAGAGTGTGG - Intergenic
920888357 1:209956453-209956475 TTCATTAAGCAGGGAGTGTGGGG + Intronic
921642237 1:217569329-217569351 TTAAGTAAGCAAGCAGAGGGTGG + Intronic
921692600 1:218166827-218166849 TTCATTATGCTTGAAAAAGGGGG + Intergenic
1062924108 10:1301597-1301619 TTAATGAACCCTGAAGAGGGAGG - Intronic
1063465035 10:6237404-6237426 TTCATTCAGCTTGCAGAAGGAGG + Intergenic
1064331850 10:14401596-14401618 TTCTCTGAGCATGGAGAGGGAGG - Intronic
1067568771 10:47356791-47356813 CTCATTATTCATGAAGAGAGAGG + Intronic
1068944655 10:62717707-62717729 TTCATTAAGTAGGCAGATGGAGG - Intergenic
1070973246 10:80585269-80585291 TTCATTTTGGAGGAAGAGGGAGG - Intronic
1071057848 10:81531543-81531565 TTCTTTAAGAATGAAGAATGGGG + Intergenic
1071197278 10:83175890-83175912 TTCCTTCTGCTTGAAGAGGGAGG - Intergenic
1074488634 10:113916139-113916161 TTCTTTGAGCATGTACAGGGTGG + Exonic
1079409776 11:20176577-20176599 CGCATAAAGCATGAAGAGAGCGG + Intergenic
1080650842 11:34221631-34221653 CTCATTCAGCTTGAATAGGGGGG + Intronic
1086313943 11:85569326-85569348 TACATTAAGAAAGAAGAGGCTGG - Intronic
1087841887 11:102928874-102928896 TGCATTAAGCAGGAAAAGGCAGG + Intergenic
1087959489 11:104330566-104330588 TTTATTAAGGAGGAACAGGGTGG + Intergenic
1088373007 11:109111915-109111937 TTCACTGACAATGAAGAGGGTGG - Intergenic
1090035389 11:123245539-123245561 TTCATTCAGCAGGAATAGGGTGG - Intergenic
1090356168 11:126141675-126141697 AGCAGTGAGCATGAAGAGGGAGG + Intergenic
1091449242 12:562349-562371 TTCCTTAGGCAAGAAGCGGGTGG + Exonic
1091511045 12:1126443-1126465 TTCATCTAGCATGAAGTAGGTGG - Intronic
1092172588 12:6383376-6383398 CACCTTAAGCATGGAGAGGGAGG - Intronic
1092548498 12:9472297-9472319 TTCTCTAAGCAGGAAGAGAGGGG - Intergenic
1092774340 12:11929300-11929322 GCCATTAATCAGGAAGAGGGTGG - Intergenic
1094666128 12:32522936-32522958 TTCATTAGGCATCAAAAGGAGGG - Intronic
1096712012 12:53464532-53464554 TTCAATAAGAATGAAGGGGTGGG - Intronic
1097685131 12:62684089-62684111 TTCACTAAGCAAGAGGATGGGGG + Intronic
1099825092 12:87765555-87765577 TTTATAAACCATGAAGAGAGTGG - Intergenic
1100320065 12:93482517-93482539 ACCCTTAAGCATGAAGAGGAAGG - Intronic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101036452 12:100711811-100711833 TTCTTTAAAAATGAAGAGGTAGG - Intergenic
1104194193 12:126515790-126515812 TTCAGTAAGAATGAATAGTGAGG - Intergenic
1104565035 12:129872983-129873005 TTCATTCAGCGTGAAGAAGGCGG + Intronic
1105567297 13:21563047-21563069 CTTTTTAAGCAAGAAGAGGGTGG - Intronic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106237759 13:27879142-27879164 TACAATATGCATGAAGATGGAGG + Intergenic
1106498083 13:30300501-30300523 TTCATTAAGCATGTAAAGCCTGG - Intronic
1107295838 13:38906442-38906464 TTCAGTAAGTATGGAGATGGTGG - Intergenic
1110843145 13:80165564-80165586 TCCATAAAGCAAGCAGAGGGTGG + Intergenic
1114651112 14:24285044-24285066 TACATTAAACAGGAAGAGGATGG - Intergenic
1114883136 14:26811976-26811998 TACATTAAGCAAGAACAAGGAGG - Intergenic
1114995187 14:28341176-28341198 TTCAATTAGGATGAAGAGTGTGG + Intergenic
1117333288 14:54735493-54735515 TTCTTTATGAATGAAAAGGGAGG - Intronic
1117893196 14:60449248-60449270 TTCTCTAAGCATGAAAACGGTGG - Intronic
1118775851 14:68973617-68973639 TTGGTCATGCATGAAGAGGGAGG + Intronic
1118965079 14:70574347-70574369 TACATTAAGAAAGAAGAGGCCGG + Intergenic
1120002946 14:79324010-79324032 TTTGTTAAGCACGAAGAGTGTGG + Intronic
1121793637 14:96718017-96718039 TTCTTTTAAAATGAAGAGGGAGG - Intergenic
1122072713 14:99214937-99214959 TTCATCAAGCATGCAGGGGTGGG + Intronic
1122449644 14:101795189-101795211 TTCCTTAAGCTTGATGAAGGAGG + Intronic
1122835628 14:104429499-104429521 TTCCTGAAACATGAGGAGGGTGG - Intergenic
1122996399 14:105267620-105267642 ATCATTAGGCATGAAGACGTTGG - Intronic
1124662210 15:31558923-31558945 TTCACCAAGCCTAAAGAGGGTGG + Intronic
1127484854 15:59409414-59409436 GTCATGAAGCATGAAGTAGGGGG - Intronic
1128312563 15:66640416-66640438 TTCATGAAGGTTGGAGAGGGAGG + Intronic
1129118719 15:73381759-73381781 TTCATTGAGCAGGAAGAGCAGGG - Intergenic
1130437648 15:83917824-83917846 TTCATTAAGCCTAATGAGGTAGG - Intronic
1133084256 16:3349537-3349559 TTCACTAAGCATGGAGACAGAGG + Intergenic
1134564251 16:15237293-15237315 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1134738243 16:16519406-16519428 TTTATTAAGCTTGAGGAGGTGGG + Intergenic
1134929256 16:18192757-18192779 TTTATTAAGCTTGAGGAGGTGGG - Intergenic
1138234133 16:55366141-55366163 TTCATTCTTCATGAAAAGGGAGG - Intergenic
1138879084 16:60988826-60988848 TTTATTAAGCAGGAGGAGAGGGG - Intergenic
1144605313 17:16659465-16659487 TTCATAAGGCATGAGGAGAGGGG + Intergenic
1145004999 17:19332731-19332753 TTCATTAGGGAAGAGGAGGGAGG - Intronic
1145405929 17:22593797-22593819 TTTATTAAGCATATAGAGGAAGG + Intergenic
1146573394 17:33971506-33971528 TTCATTATGCATGAATGGGAGGG - Intronic
1150438206 17:65170351-65170373 TTCAATAAGAATGCAGAAGGCGG - Intronic
1151259216 17:72903660-72903682 TTCATTAAATTTGAAGGGGGAGG + Intronic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1154931080 18:20997007-20997029 TTCATTAAGCAGAAACAGGAAGG + Intronic
1156197731 18:34794563-34794585 TTAATGAAGCGTGAAGTGGGAGG + Intronic
1158991333 18:62871976-62871998 TTTATTAAGGATGTATAGGGAGG + Intronic
1162471496 19:10874685-10874707 TTACTTAAGGATAAAGAGGGCGG - Intronic
1167803176 19:51759715-51759737 AGCATTAAGTATGTAGAGGGCGG - Intronic
1167836510 19:52076296-52076318 TTCACTAAGCATTCAGAAGGAGG - Intronic
925881453 2:8356267-8356289 ATCATTAACCATGAGGAAGGTGG + Intergenic
926024161 2:9525416-9525438 TTCATGAAGCAAGAAGAAGCTGG - Intronic
927333833 2:21897386-21897408 TTCATTAGCCATGAAGAAGAGGG + Intergenic
927392100 2:22607176-22607198 GGCAGTATGCATGAAGAGGGTGG - Intergenic
928646464 2:33357712-33357734 TTCAATTTGCATGAAGAGGCTGG - Intronic
933044297 2:77516032-77516054 TCCATTTAGGATGAGGAGGGGGG - Intronic
933918880 2:87024958-87024980 TTCCTTTAGCATGGAGAGGCTGG - Intergenic
934004114 2:87744958-87744980 TTCCTTTAGCATGGAGAGGCTGG + Intergenic
935767072 2:106378969-106378991 TTCCTTTAGCATGGAGAGGCTGG + Intergenic
935911848 2:107904973-107904995 TTCCTTTAGCATGGAGAGGCTGG + Intergenic
936978507 2:118242434-118242456 GTCATTAGGCATACAGAGGGTGG + Intergenic
937257276 2:120564468-120564490 TACATTAAACAAGAGGAGGGCGG + Intergenic
938258600 2:129879630-129879652 TTAATTAAGCATTAATAGGGTGG - Intergenic
938903287 2:135816567-135816589 TTCATTTAGCCTGATCAGGGTGG - Intronic
944334325 2:198512691-198512713 TGCATTAAACATGAAGATAGTGG - Intronic
945318990 2:208399791-208399813 ATCATTAAGCATGATGGTGGTGG + Intronic
1171504506 20:25623035-25623057 CTGATGAAGCATGAAGAGGACGG + Intronic
1173994635 20:47328283-47328305 TTTTATAAGCATGGAGAGGGTGG + Intronic
1178189782 21:30267176-30267198 TCCATTAGGCAGGTAGAGGGAGG + Intergenic
1179038673 21:37782673-37782695 TTTATCAAGGAAGAAGAGGGTGG + Intronic
1184202211 22:42978488-42978510 GTCATTCAGCAGGATGAGGGTGG - Intronic
1184590011 22:45475929-45475951 TTCACTGAGCATGCAGAGAGAGG + Intergenic
950255936 3:11505916-11505938 TTTACTAATCATGAAGATGGTGG - Intronic
951743686 3:25952991-25953013 TTCATTAAGGAAGAAGTAGGCGG - Intergenic
952833603 3:37585774-37585796 TTTCTTAAGCAGGAAGAAGGGGG + Intronic
953628480 3:44590834-44590856 ATCATTAAGGATGAAGCAGGTGG - Intronic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
962598562 3:136971785-136971807 TGCAATAAACATGAAAAGGGAGG + Intronic
966155984 3:176917042-176917064 TTGATTAGGTATGAAGAGTGGGG - Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
968885746 4:3330880-3330902 TTCCTTCAGCAGGAAGAGGGAGG + Intronic
970513718 4:16806333-16806355 TTTCTTAAGAATGAAGAGTGGGG + Intronic
970672070 4:18408062-18408084 TTCAGAAATCATGAAGAGGCTGG + Intergenic
970829627 4:20321652-20321674 TTCATAAAGCATGAAATGCGTGG + Intronic
971167923 4:24203240-24203262 TTCATTAAGAATGACCAGGCCGG + Intergenic
971401943 4:26284341-26284363 TTCACTAAGTATGAAGTTGGAGG - Intronic
974227840 4:59070679-59070701 TTAATGAAGAATAAAGAGGGAGG + Intergenic
976527492 4:86111264-86111286 TTTAATAGGCATGAAGAGAGAGG + Intronic
976847433 4:89505970-89505992 TTCATTAAGAAGGAAAAAGGAGG - Intergenic
976994651 4:91415449-91415471 TTGATTAAGCATGGTAAGGGAGG + Intronic
977560375 4:98526916-98526938 TTCATGAAAAATGAAGAGTGAGG + Intronic
978278953 4:106986272-106986294 TTTATAAAACATGAAGAAGGAGG - Intronic
979071420 4:116212727-116212749 CACCTTAAGCATGAAGAGGCTGG + Intergenic
980601076 4:135026043-135026065 ATCATTTTGCATGAAGAAGGAGG - Intergenic
986068338 5:4257706-4257728 TTAATTAAGCAGGAAAAGAGAGG - Intergenic
987878248 5:23709511-23709533 TTCAGGGAGCATGAGGAGGGAGG - Intergenic
989119820 5:37993233-37993255 TTTGATAAGCATGAAGATGGAGG - Intergenic
991050604 5:62268814-62268836 CTTATTAAGCCTGAAGAAGGTGG - Intergenic
992300683 5:75376338-75376360 ATCATAAAGCATCAAGAGGGAGG + Intronic
999147636 5:149406592-149406614 GTCATTAAGCCTGAGAAGGGGGG - Intergenic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999665358 5:153907102-153907124 TTCATTAAGCATTTAGATGTAGG + Intergenic
999778003 5:154826163-154826185 GACATTCAGCATGAAGAGGTTGG + Intronic
1000063354 5:157675078-157675100 TTCATTAAGCTGGAGCAGGGAGG - Exonic
1000556240 5:162729654-162729676 TTCATTAAGCCTGGAGAGAAGGG - Intergenic
1001174626 5:169456104-169456126 TTCACTAAGCTTGAAGAGCTTGG + Intergenic
1004735004 6:18396791-18396813 TTGTTTAAGCATGAACTGGGAGG + Intronic
1006590337 6:35150542-35150564 TTCACTAAGCGTGGAGAGGCAGG + Intergenic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1012453829 6:99382510-99382532 TGCATTAAGCATGGACAAGGGGG - Intronic
1014018349 6:116560734-116560756 TCCATTAAGCATAAAGGGGAGGG - Intergenic
1015066392 6:129034281-129034303 TTTATTAAGCATGAAGTGATTGG + Intronic
1015495358 6:133876238-133876260 TACATTAGGTATGAAGAAGGAGG - Intergenic
1017092727 6:150775309-150775331 TTCTTTAAGAATGAAGAGTGAGG + Intronic
1018306713 6:162464895-162464917 TTTATTAAGAAGGAGGAGGGGGG - Intronic
1018837023 6:167492809-167492831 CTGATAAGGCATGAAGAGGGAGG + Intergenic
1020248885 7:6451363-6451385 TTCATTAAGCAGAAAGAATGTGG + Intronic
1020877279 7:13713797-13713819 TTCATTGTGCCTGAAAAGGGTGG - Intergenic
1021185730 7:17562598-17562620 CTCATTAAGCAGGAAGCTGGAGG - Intergenic
1021916801 7:25442371-25442393 TTCTTTAAGAATGCGGAGGGAGG + Intergenic
1022270975 7:28807806-28807828 TTTATTGAGAATGAAGAAGGAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024597437 7:50951573-50951595 TTTATTAAACAGGAAGAGGTGGG + Intergenic
1026220923 7:68396977-68396999 CTCATTAGGAATGAAGTGGGGGG + Intergenic
1031044932 7:116876907-116876929 TTTAGTAAGTATCAAGAGGGTGG + Intronic
1031376152 7:121028182-121028204 TTCAGTAAGAATGGAGAGGCAGG + Intronic
1033507665 7:142021788-142021810 GTCTGTAAGCATGAAGAAGGGGG + Intronic
1033773133 7:144576618-144576640 TTCATTATGAATGAAGAGCCTGG + Intronic
1034069260 7:148167104-148167126 TTTATAAATTATGAAGAGGGAGG + Intronic
1034486247 7:151365421-151365443 TTTACTAAGCATCAAGAGCGTGG - Intronic
1039203516 8:35123436-35123458 TTCCTAAAGCATCATGAGGGTGG - Intergenic
1041008671 8:53520301-53520323 TTGATTGAGCATGTAGATGGGGG + Intergenic
1041031154 8:53736501-53736523 TTGATTGAGCATGTAGATGGGGG - Intronic
1042842521 8:73138325-73138347 GTCATTAAGGATAAAGAGTGTGG + Intergenic
1045358754 8:101412946-101412968 TGGATTAAGAAGGAAGAGGGAGG - Intergenic
1045693407 8:104782394-104782416 TTCAGTGAGCATGACGAGAGTGG - Intronic
1045735000 8:105284761-105284783 CTCTTTAACAATGAAGAGGGTGG + Intronic
1046664816 8:116989111-116989133 TGAATTAAGCATGAAGGAGGAGG + Intronic
1048100660 8:131347735-131347757 TTCATTAAGCAAGTATAGGGAGG - Intergenic
1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG + Intergenic
1052162009 9:25274311-25274333 TTCACTAACCATGAAGAGTTAGG + Intergenic
1052240018 9:26260430-26260452 TTTAGAAAGCAGGAAGAGGGAGG + Intergenic
1052391482 9:27883325-27883347 TGCATTAAGCATGACTGGGGAGG - Intergenic
1054924425 9:70575186-70575208 TTCATTTAAAATGAGGAGGGAGG - Intronic
1057636880 9:96777421-96777443 ATCATTAAAAATGAAGAAGGAGG - Intronic
1058873296 9:109220889-109220911 TCCATGGGGCATGAAGAGGGTGG - Intronic
1059709618 9:116855591-116855613 GTCAGGAAGCATGAAGAGAGGGG - Intronic
1061585261 9:131563022-131563044 ACCATTAAGAATGAAAAGGGAGG - Intergenic
1186567432 X:10678651-10678673 TTCATTAAACATGAAGGAGATGG - Intronic
1186975071 X:14893697-14893719 TTCTGCAAGCATGAAGAGTGAGG - Intronic
1188820904 X:34773856-34773878 TTCATTTAGCATCAAAAAGGAGG + Intergenic
1188841151 X:35019321-35019343 TTCCTTAAGGCTGAAGAGTGTGG - Intergenic
1190057974 X:47193084-47193106 TTCATTATTCATGAACAGGAAGG + Intronic
1191635289 X:63369221-63369243 TTCTATAAGCAAGAAGAGAGTGG + Intergenic
1193631512 X:83894061-83894083 TTCATTCACCATGAAGAAGTAGG - Intergenic
1199345867 X:146738673-146738695 TTCAATTAGCAGGAAGAAGGCGG - Intergenic
1200345392 X:155442044-155442066 TTCATGAAGCATGATGGGGGTGG + Intergenic
1200413232 Y:2882294-2882316 TTCAGTAAGAATGAAGAGTTGGG - Intronic