ID: 967166561

View in Genome Browser
Species Human (GRCh38)
Location 3:186784456-186784478
Sequence GGACCCCGATGGTGTCATCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967166561 Original CRISPR GGACCCCGATGGTGTCATCG AGG Exonic
902990031 1:20180848-20180870 GGACCCAGATGGTGGCGTCTAGG - Intergenic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
903339853 1:22647152-22647174 GGACCCTGAGGGTGTCTTCCAGG - Intronic
910460920 1:87447277-87447299 GGAACACGGTGGTGTCATCTCGG + Intergenic
1072289818 10:93953473-93953495 GGACCCAGATAGTGTCATGATGG - Intronic
1076903325 10:133350486-133350508 GGACCACGTGGGTGTCATCCGGG - Intronic
1082831847 11:57624152-57624174 GGACCACGATGGTGTGGTCATGG + Intergenic
1085761003 11:79241465-79241487 TGAGCCTGATGGTCTCATCGGGG - Intronic
1091930911 12:4394557-4394579 GGATCCTGAAGGTGACATCGGGG + Intergenic
1094051576 12:26226572-26226594 GGAACGCGCTGGTGGCATCGAGG - Intronic
1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG + Exonic
1118335182 14:64847385-64847407 GGACCCCGATGTGGGCATCTAGG + Intronic
1136142401 16:28295878-28295900 GGCCCCCGATGCTGGCATCTGGG + Intronic
1136289096 16:29260830-29260852 GGACCCCGATGGGGACGTAGAGG + Intergenic
1136903981 16:34069706-34069728 GGACTCAAATGGAGTCATCGTGG + Intergenic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1141599000 16:85114041-85114063 GGACCCCGGTGGTGGGATCAGGG - Intergenic
1142094825 16:88233757-88233779 GGACCCCGATGGGGACGTAGAGG + Intergenic
1143541990 17:7574287-7574309 GGAGCCCGAAGGCGTCATCGAGG + Exonic
1145999322 17:29121877-29121899 GGACCACGATGGGGCCATCCTGG - Exonic
1148091589 17:45025491-45025513 GGACCCAGATGGTGACCTCAGGG - Intronic
1148113048 17:45157749-45157771 GGAGCGCGATGGTGTGATCTTGG - Intergenic
1203189228 17_KI270729v1_random:163205-163227 GGAATCCAATGGAGTCATCGAGG - Intergenic
1161020117 19:2005729-2005751 GGAGCGCGATGGTGTGATCTTGG - Intronic
1163312616 19:16523105-16523127 GGACCAGGCTGGGGTCATCGTGG + Exonic
1164150513 19:22546306-22546328 GGACACCGATGGTGAGTTCGGGG + Intergenic
927668871 2:25052143-25052165 GGAGCCCAATGGTGTGATCTTGG - Intronic
927932667 2:27055221-27055243 GAACCCCGATGGTGTGGTCCGGG + Exonic
936163731 2:110103140-110103162 GGACCCCGCTGGTATCTTCTAGG + Intronic
943853087 2:192753751-192753773 GGAGCCCAATGGTGTGATCTTGG + Intergenic
946356999 2:219193618-219193640 GGAGCGCAATGGTGCCATCGTGG + Intergenic
1174345566 20:49926904-49926926 GGATTCCAATGGTGTGATCGTGG - Intergenic
1175249045 20:57597938-57597960 GGACCCCTGTGATGACATCGAGG - Intergenic
1176624670 21:9083047-9083069 GGACGCCGATGTTGACATCAGGG - Intergenic
1179205819 21:39277612-39277634 GGAGCCCAATGGTGTGATCTCGG + Intronic
1180127758 21:45803765-45803787 GGACCCAGATGGTGACAGCCTGG + Intronic
1180604008 22:17041843-17041865 GGAGTGCGATGGTGTCATCTTGG - Intergenic
1183374401 22:37454593-37454615 GGGCCCCAATGGTGTCTTCAGGG - Intergenic
954304528 3:49718472-49718494 GCACCGCGATGCTGCCATCGCGG + Exonic
956866652 3:73375819-73375841 GGAGCGCGATGGTGTGATCTCGG + Intergenic
963889735 3:150620309-150620331 GGTACCCGATGGTGGCATTGTGG + Intronic
967166561 3:186784456-186784478 GGACCCCGATGGTGTCATCGAGG + Exonic
968595406 4:1479689-1479711 GGACCCAGATGGTGACCTGGAGG + Intergenic
973897135 4:55424537-55424559 GGACCCCTATGGTGTAGCCGTGG + Exonic
977974283 4:103245856-103245878 GGACCCTGGTAGTGTCATCAGGG - Intergenic
978368680 4:108008677-108008699 GCACACTGTTGGTGTCATCGAGG + Intronic
987489538 5:18560195-18560217 GGAGTCCGATGGTGTGATCTCGG + Intergenic
989387350 5:40866891-40866913 GGACCCCCAAGGTGTCACGGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1016392186 6:143585575-143585597 GGAGTCTGATGGTGTCATCTTGG + Intronic
1022807316 7:33835505-33835527 TGACCCTGATGGTGTCACTGAGG + Intergenic
1025485419 7:61041432-61041454 GGACTCCAATGGTGTAATCATGG + Intergenic
1029289713 7:99492899-99492921 GGAGCCCAGTGGTGTGATCGTGG - Intronic
1031830477 7:126619739-126619761 GGAACTCGGTGGTGTCATCTTGG + Intronic
1039213636 8:35243125-35243147 GCCCCCAGATGGTGTCATCTGGG - Intronic
1059448052 9:114351266-114351288 AGACTCGGATGGTGTCATGGTGG - Intronic
1059591573 9:115668304-115668326 GGACCCTGGTAGTGTCATCAGGG - Intergenic
1060149534 9:121279453-121279475 GGACCCAGATGTTGGCATTGGGG + Intronic
1061131810 9:128712782-128712804 GGCCTCCTAGGGTGTCATCGGGG + Intronic
1203747839 Un_GL000218v1:53475-53497 GGACGCCGATGTTGACATCAGGG - Intergenic
1186509072 X:10117135-10117157 GCACCCTGACGGTGTCCTCGGGG + Exonic
1189818055 X:44844128-44844150 GGACGCGGATGCTGTCATCAAGG - Exonic
1201889673 Y:18928329-18928351 GGAGTGCGATGGTGTCATCTTGG - Intergenic