ID: 967171547

View in Genome Browser
Species Human (GRCh38)
Location 3:186826544-186826566
Sequence TCCCCAAGGCTGCTCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967171536_967171547 10 Left 967171536 3:186826511-186826533 CCACCCCAGAGAGGCCCCATCCT No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171540_967171547 -4 Left 967171540 3:186826525-186826547 CCCCATCCTTTCCTTTCTTTCCC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171535_967171547 11 Left 967171535 3:186826510-186826532 CCCACCCCAGAGAGGCCCCATCC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171542_967171547 -6 Left 967171542 3:186826527-186826549 CCATCCTTTCCTTTCTTTCCCCA No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171534_967171547 14 Left 967171534 3:186826507-186826529 CCTCCCACCCCAGAGAGGCCCCA No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171538_967171547 6 Left 967171538 3:186826515-186826537 CCCAGAGAGGCCCCATCCTTTCC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171544_967171547 -10 Left 967171544 3:186826531-186826553 CCTTTCCTTTCTTTCCCCAAGGC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171537_967171547 7 Left 967171537 3:186826514-186826536 CCCCAGAGAGGCCCCATCCTTTC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171539_967171547 5 Left 967171539 3:186826516-186826538 CCAGAGAGGCCCCATCCTTTCCT No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data
967171541_967171547 -5 Left 967171541 3:186826526-186826548 CCCATCCTTTCCTTTCTTTCCCC No data
Right 967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967171547 Original CRISPR TCCCCAAGGCTGCTCCAGCA GGG Intergenic
No off target data available for this crispr