ID: 967171795

View in Genome Browser
Species Human (GRCh38)
Location 3:186827569-186827591
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967171786_967171795 6 Left 967171786 3:186827540-186827562 CCTCGCGGGACGGGGACCCCTAG No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171777_967171795 24 Left 967171777 3:186827522-186827544 CCGCCGCCCGGCGAAGGACCTCG No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171776_967171795 25 Left 967171776 3:186827521-186827543 CCCGCCGCCCGGCGAAGGACCTC No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171778_967171795 21 Left 967171778 3:186827525-186827547 CCGCCCGGCGAAGGACCTCGCGG No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171781_967171795 18 Left 967171781 3:186827528-186827550 CCCGGCGAAGGACCTCGCGGGAC No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171782_967171795 17 Left 967171782 3:186827529-186827551 CCGGCGAAGGACCTCGCGGGACG No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data
967171787_967171795 -10 Left 967171787 3:186827556-186827578 CCCCTAGTGCGCCTGCGCGAGCG No data
Right 967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type