ID: 967172477

View in Genome Browser
Species Human (GRCh38)
Location 3:186832763-186832785
Sequence CTGTGGTCACAGATAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967172471_967172477 27 Left 967172471 3:186832713-186832735 CCTAGAACAATGTCTTTATCTGC No data
Right 967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG No data
967172470_967172477 28 Left 967172470 3:186832712-186832734 CCCTAGAACAATGTCTTTATCTG No data
Right 967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967172477 Original CRISPR CTGTGGTCACAGATAGGGGA AGG Intergenic
No off target data available for this crispr