ID: 967173252

View in Genome Browser
Species Human (GRCh38)
Location 3:186840541-186840563
Sequence AGGTTGATGTATGTGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967173252_967173263 18 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173263 3:186840582-186840604 CAAGAGGGGTGAAGGGCATGAGG 0: 1
1: 0
2: 3
3: 29
4: 380
967173252_967173256 2 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173256 3:186840566-186840588 AGGCCTCACACTCCATCAAGAGG 0: 1
1: 0
2: 3
3: 8
4: 118
967173252_967173257 3 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173257 3:186840567-186840589 GGCCTCACACTCCATCAAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 150
967173252_967173260 10 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173260 3:186840574-186840596 CACTCCATCAAGAGGGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 115
967173252_967173261 11 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173261 3:186840575-186840597 ACTCCATCAAGAGGGGTGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 116
967173252_967173258 4 Left 967173252 3:186840541-186840563 CCCTGAAGCACATACATCAACCT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 967173258 3:186840568-186840590 GCCTCACACTCCATCAAGAGGGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967173252 Original CRISPR AGGTTGATGTATGTGCTTCA GGG (reversed) Intergenic
901140644 1:7027080-7027102 TGGTTGAAGTCTGTGCTTCAGGG + Intronic
902350987 1:15854270-15854292 AGGCTAATATATGTGTTTCAAGG - Intronic
903600630 1:24536194-24536216 ACGTTTATGTATGTCATTCATGG + Exonic
903858786 1:26353000-26353022 AGGTTGCTGTGTGGGCTCCAGGG - Intronic
906025338 1:42668760-42668782 AGTTTGATGTATGTCCATCAGGG + Intronic
909978916 1:82074982-82075004 AGGTTGAAGCAGGTGTTTCAAGG - Intergenic
910126241 1:83845670-83845692 AGGATGATGAATGTGCATTAAGG + Intergenic
911559573 1:99388205-99388227 AGGTTGATTCATGTACTTCAAGG + Intergenic
914387168 1:147180930-147180952 AGGCTGATGTTTCTGCCTCAAGG + Intronic
917147859 1:171911901-171911923 AGATTCATGTATGGGCTTCGTGG + Intronic
918958638 1:191241851-191241873 ACATTGATGTATTTGCTTCTAGG + Intergenic
921015758 1:211189127-211189149 TGGTTGATGTAGGATCTTCACGG - Intergenic
924665539 1:246067816-246067838 AGGCTGTTGTATGTGCACCAAGG + Intronic
1063019752 10:2115995-2116017 AGGTTGTTATTTCTGCTTCATGG - Intergenic
1074691501 10:116009184-116009206 AGGTTGGTTTATGTGGTTTAAGG + Intergenic
1075557643 10:123444959-123444981 AGGTTGGGGTCTGTGCTTGAGGG - Intergenic
1083256057 11:61496165-61496187 AGGTTGCTGTTTGTTCGTCATGG + Intergenic
1084433563 11:69124685-69124707 AGGTTGGTCTTTGTGCCTCAGGG + Intergenic
1084462297 11:69302691-69302713 AGGCTGATGTATGGGCCTCATGG - Intronic
1087681010 11:101218422-101218444 AGTTTGATTGCTGTGCTTCATGG + Intergenic
1090875957 11:130789314-130789336 AGGTTGATCTGTCTCCTTCATGG + Intergenic
1091365959 11:135020639-135020661 GTGTTCATGTGTGTGCTTCAGGG - Intergenic
1092279653 12:7089711-7089733 ACCTTGATGAATGTGCTTCCCGG - Exonic
1096505734 12:52091480-52091502 AGGTGGATGTGTCTGCTTCTTGG + Intergenic
1097944775 12:65354672-65354694 AGGTAGATGTATAGGTTTCATGG + Intronic
1099251255 12:80257682-80257704 TGGTTCCTGTCTGTGCTTCAGGG - Intronic
1101234291 12:102772827-102772849 AGGTTGATGTGTTAGCTTTATGG + Intergenic
1105800596 13:23899878-23899900 AGGCTCATGTATATTCTTCATGG - Intronic
1111377571 13:87400691-87400713 AAGTTGAGGTAGGTACTTCAAGG - Intergenic
1113003747 13:105675654-105675676 AATTTGATGTATGAACTTCAAGG + Intergenic
1113738290 13:112693394-112693416 AGGGTGATGTATGTGCTGTCGGG + Intronic
1114845596 14:26316937-26316959 AGGTTGAGATATTTGGTTCATGG + Intergenic
1115419048 14:33171491-33171513 AGGTTGGTTTATGTGGTTTAGGG - Intronic
1116428024 14:44813593-44813615 AGGACAATGTAGGTGCTTCATGG - Intergenic
1117027874 14:51639986-51640008 AGGTTGATGTAGAAGCTTCTGGG + Intronic
1122646214 14:103196188-103196210 AGGTCTATGTATTTGCTTCCTGG + Intergenic
1122734113 14:103825675-103825697 AGGTTGGTTCATGAGCTTCAAGG + Intronic
1202829170 14_GL000009v2_random:7557-7579 AGGATGATGTATTTGCTGCCTGG + Intergenic
1202900886 14_GL000194v1_random:37409-37431 AGGATGATGTATTTGCTGCCTGG + Intergenic
1126060681 15:44778721-44778743 AAGTTCATGAATGGGCTTCAAGG - Intergenic
1130674552 15:85940284-85940306 ATTTTGATTTATGTGCTGCAGGG + Intergenic
1131547043 15:93324196-93324218 TGGTTGATGGATGAGCTTCTGGG + Intergenic
1132266052 15:100471708-100471730 AGATTATTATATGTGCTTCAGGG - Intronic
1136700032 16:32126723-32126745 AGGTTGATGAATGTTTTTCTTGG + Intergenic
1139531518 16:67544865-67544887 AGGCTGAGGTAGGAGCTTCAAGG - Intronic
1140669868 16:77267804-77267826 ATGTTTATGTAGTTGCTTCATGG + Intronic
1146631135 17:34470140-34470162 GGATTGATGAATGGGCTTCAAGG + Intergenic
1150190267 17:63231327-63231349 TTGTTGATGTAGTTGCTTCATGG + Intronic
1154343721 18:13525538-13525560 AAGTTGATGGGCGTGCTTCAGGG + Intronic
1156050831 18:32931567-32931589 TGGGTGATGTATGTGCTACTCGG + Intergenic
1156341182 18:36211986-36212008 AGGCTGCTGTGTGTGCTGCAAGG + Intronic
1156519159 18:37706898-37706920 AGGTTAATGTATGTGAAGCAGGG + Intergenic
1161867598 19:6844993-6845015 ATGTTGATGTTTGTTCATCATGG + Intronic
1163804640 19:19388028-19388050 AGCTTGATGTGAGTGCTCCAAGG - Intronic
1165924604 19:39319751-39319773 AGGATGCTGAATGTGCTGCAGGG - Intergenic
1166409650 19:42547957-42547979 AGGGTGATGTGTGTGGTTCCAGG + Intronic
1168321112 19:55510295-55510317 AGCTTGATTTGTGTTCTTCATGG + Intronic
1202643526 1_KI270706v1_random:120232-120254 AGGATGATGTATTTGCTGCCTGG - Intergenic
925215495 2:2091829-2091851 AGGTTGGTTTATGAGGTTCAAGG - Intronic
929341731 2:40827194-40827216 AGGTTTATGTCTGAGCATCAAGG - Intergenic
930851071 2:55961095-55961117 AGCTTGCTCTAAGTGCTTCACGG - Intergenic
932307924 2:70716970-70716992 AGGTTGTTGTGTGTGATGCATGG - Intronic
932462723 2:71893761-71893783 AGGATGATGTATGGGCTGCGGGG - Intergenic
933490059 2:82974579-82974601 AAGTTGTTTTGTGTGCTTCAGGG - Intergenic
934505902 2:94893799-94893821 AGGATGATGTATTTGCTGCCTGG - Intergenic
934871524 2:97871081-97871103 AGGTTAAAGTAGGTACTTCATGG - Intronic
942294750 2:174506882-174506904 AGGGTGATGTAGGTGATTCAAGG - Intergenic
942893446 2:181020087-181020109 AGGTTGATGTATTAGTTTCCTGG + Intronic
944311203 2:198235732-198235754 AGATTCATGTATGTGCATCAGGG + Intronic
947359329 2:229331856-229331878 AGGATGATAGAAGTGCTTCAGGG - Intergenic
1169159744 20:3367148-3367170 AGGTTGATTTATGAGGTTTAAGG - Intronic
1171893490 20:30739171-30739193 AGGATGATGTATTTGCTGCCTGG - Intergenic
1173410179 20:42803222-42803244 ACGTTGATGTATCTGGCTCAGGG - Intronic
1175178495 20:57128300-57128322 AGGCTGATGTCTGAGCTCCATGG - Intergenic
1175766768 20:61597748-61597770 AGGTTGATGTGGCTCCTTCATGG - Intronic
1176608354 21:8852396-8852418 AGGATGATGTATTTGCTGCCTGG + Intergenic
1176620260 21:9052187-9052209 AGGATGATGTATTTGCTGCCTGG + Intergenic
1177758776 21:25379117-25379139 AGAATGATGTATATGCTTCTGGG - Intergenic
1179990218 21:44944345-44944367 AGGCTGACGTGTGTGCTGCAGGG - Intronic
1180013868 21:45070263-45070285 AGGAAGATGTCTTTGCTTCAGGG - Intergenic
1180358440 22:11862201-11862223 AGGATGATGTATTTGCTGCCTGG + Intergenic
1180379822 22:12130129-12130151 AGGATGATGTATTTGCTGCCTGG - Intergenic
1182427040 22:30279424-30279446 ATGTGGATGTGTGTGCTGCATGG - Intergenic
1183003765 22:34883148-34883170 AGGTTGATGTAGTTACTTCTGGG - Intergenic
950013878 3:9742846-9742868 AGGTTGCTGGATGTGTTTCAGGG + Intronic
951427501 3:22564510-22564532 AGGAAGATGTATGTGGTTCTGGG - Intergenic
952527655 3:34228225-34228247 AAGTTCATGAATGGGCTTCAGGG + Intergenic
957091676 3:75736648-75736670 AGGTTGGTATATGAGCTTCTAGG + Intronic
957481758 3:80806915-80806937 AGGTTATTGTATTTGCTTAATGG + Intergenic
960824676 3:121770453-121770475 GGGTGCTTGTATGTGCTTCAGGG + Exonic
962368320 3:134800593-134800615 ATCCTGATGTATGTGCTTCCTGG + Intronic
962781640 3:138724308-138724330 AGGTATATATATGTTCTTCAAGG + Intronic
964398781 3:156276665-156276687 AGGTTGATGCATGAGTTTTAAGG - Intronic
964504566 3:157384732-157384754 AGGTACATGGATGTGCTCCAAGG - Intronic
965549737 3:169952296-169952318 AGGATGATGAATGTTCTCCATGG + Intergenic
965719126 3:171641837-171641859 AGTTTGATGAATTTGCTCCAGGG + Intronic
967173252 3:186840541-186840563 AGGTTGATGTATGTGCTTCAGGG - Intergenic
967908058 3:194517975-194517997 AGGTTGATGTCAGCCCTTCAGGG + Intergenic
969983145 4:11179603-11179625 AGATTGAAGCATGTTCTTCATGG + Intergenic
971151882 4:24041739-24041761 GGATCCATGTATGTGCTTCATGG - Intergenic
971441313 4:26690240-26690262 AGGTTGGTTTATGTGGTTGAAGG + Intronic
972108134 4:35519571-35519593 AGGTTGATACATGTGCATTAGGG + Intergenic
972404156 4:38730773-38730795 AGGTTGAGGTTTGGCCTTCAGGG + Intergenic
976061479 4:81133324-81133346 AGTTTAATGTATGTGATTCCTGG + Intronic
979541518 4:121888989-121889011 AGGTAGCTGTAAGTGCTTCCTGG - Intronic
979559845 4:122089375-122089397 GGGTTGGTGTACCTGCTTCATGG - Intergenic
979709278 4:123758660-123758682 AGGCTCAGGTATGTTCTTCATGG + Intergenic
983086651 4:163453465-163453487 AGGTTGATTTATGAGGTTCAAGG - Intergenic
983901243 4:173136908-173136930 AGGTTTGTGTAAGTGCTTTATGG - Intergenic
984605283 4:181778839-181778861 AGGTTGATGAATGTCCTTATTGG + Intergenic
1202770894 4_GL000008v2_random:206146-206168 AGGATGATGTATTTGCTGCCTGG - Intergenic
987685450 5:21193699-21193721 ATGTTGATGTATTAGTTTCATGG - Intergenic
990605588 5:57406736-57406758 AGGCTGATTTCTCTGCTTCAGGG + Intergenic
991004125 5:61811072-61811094 AGGTTTATGGATGGGCTTTAGGG - Intergenic
993266927 5:85738466-85738488 AGGTTTATGAATATGCTTCTGGG + Intergenic
993693876 5:91036799-91036821 AGGTATAAGAATGTGCTTCACGG - Intronic
994617067 5:102117313-102117335 AGGTGGATGTAATTGATTCATGG + Intergenic
997216083 5:132111881-132111903 AGGTAGATGTAAGTACTCCAAGG - Intergenic
1000995848 5:167958548-167958570 TGGTTGATGTAGTTTCTTCATGG + Intronic
1005208315 6:23430834-23430856 AGGTTGATGCAGTTTCTTCATGG + Intergenic
1006951756 6:37828060-37828082 CTGTTGATGTATCTGCTTCTTGG + Intronic
1008392537 6:50969560-50969582 AGGTTCATGAAGCTGCTTCAAGG + Intergenic
1008516253 6:52322050-52322072 AGGTTGATGCATGAGGTTTAAGG - Intergenic
1009023663 6:57972134-57972156 AACTTGAAGTATGTGCCTCAAGG - Intergenic
1009199237 6:60723686-60723708 AACTTGAAGTATGTGCCTCAAGG - Intergenic
1011998670 6:93625150-93625172 AGGTTGATGTATTGCCTACAGGG + Intergenic
1012151166 6:95756349-95756371 GGGTTGATGAATGTGGTACATGG - Intergenic
1014237161 6:118970845-118970867 AGGTCAATGTCTGTGATTCATGG + Intronic
1014478071 6:121899689-121899711 AGGTTGATTCATGAGCTTTAAGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1015469240 6:133585089-133585111 AGGTTCAAGTGTGTACTTCATGG - Intergenic
1015648041 6:135417350-135417372 ACGTAGGTGTATGTGCTTCTGGG - Intronic
1016696692 6:147004454-147004476 AGGTTGTTGTTTGTGCTTTAAGG - Intergenic
1017136565 6:151152489-151152511 AGGTTTATGTCTGTGCCCCAGGG - Intergenic
1018453143 6:163927600-163927622 AGGTTCAGGTATATGCATCAGGG + Intergenic
1019101705 6:169635844-169635866 AGATTGATATATTTGCTTCTTGG - Intronic
1020719163 7:11719837-11719859 AGGTTTATGTATAGGGTTCAGGG - Intronic
1024208760 7:47186061-47186083 CGAGTGATGTCTGTGCTTCAGGG - Intergenic
1028635924 7:92989413-92989435 AGGCTAATGGAGGTGCTTCAGGG + Intergenic
1029067826 7:97870048-97870070 AGGGTGATTTATTTGCTTCCGGG - Intronic
1029834744 7:103297417-103297439 AGGATGAAGGATGTGCTTCCGGG - Exonic
1030859443 7:114606320-114606342 AGGTAGGTACATGTGCTTCAAGG + Intronic
1031338065 7:120562210-120562232 ATGTTGGTGTTTGTACTTCAGGG - Intronic
1031833873 7:126658682-126658704 GGGATGATGTATGTGCTCTAAGG + Intronic
1032650319 7:133871127-133871149 AGGATTATCTATGTTCTTCAGGG + Intronic
1032679629 7:134168458-134168480 TGGTTGATGTTTGAGCTGCATGG + Intronic
1035426223 7:158776508-158776530 AGGTTGGTTTATGAGGTTCACGG - Intronic
1037021007 8:13970094-13970116 AGTTTGTTGTATGTGCTACAAGG + Intergenic
1037104435 8:15088724-15088746 AGAATGATGTCTGTGCCTCATGG - Intronic
1037290642 8:17346106-17346128 AGGTGGATTTCTGTGCTTAATGG - Intronic
1040355616 8:46615416-46615438 AGGATGATTTATTTGCTTCCAGG - Intergenic
1042094791 8:65202116-65202138 ATTTTTATGTATGTGCTTCTTGG + Intergenic
1045257126 8:100535645-100535667 AGGTTCCTGTATGTGCTGTATGG - Intronic
1046595264 8:116254007-116254029 AAGTTGATTTATGTACTACAAGG + Intergenic
1047141723 8:122148232-122148254 ATGTTTATCTAAGTGCTTCAGGG - Intergenic
1047147659 8:122222870-122222892 AGGTTGATTTATGAGGTTTAAGG - Intergenic
1048458536 8:134600940-134600962 AGATTTATGCATGTGCATCATGG - Intronic
1051884470 9:21875860-21875882 AGATTGATGTATGTTCCTCTGGG + Intronic
1053208852 9:36210617-36210639 TGGTTTATGTTTGTGCTTAAAGG - Exonic
1054355147 9:64053541-64053563 AGGATGATGTATTTGCTGCCTGG + Intergenic
1054959677 9:70954005-70954027 AGGTGGATGTAATTTCTTCAGGG - Intronic
1055887241 9:81078009-81078031 TGGTTAATGTAAGGGCTTCAAGG - Intergenic
1058530141 9:105898487-105898509 TTGTTGATGTAGTTGCTTCATGG + Intergenic
1059072536 9:111153870-111153892 AGTTTGATTAATTTGCTTCAAGG + Intergenic
1059990005 9:119855986-119856008 AGGTTGAGTCATTTGCTTCAAGG + Intergenic
1060185001 9:121558836-121558858 AGGTTGATATATGAGGTGCATGG + Intergenic
1060274595 9:122172800-122172822 AGGGTGAAGTATGTGCTTAGGGG + Intronic
1061952293 9:133943296-133943318 AGGTTGCTGCAGGTGCATCATGG + Intronic
1203703755 Un_KI270742v1:17609-17631 AGGATGATGTATTTGCTGCCTGG + Intergenic
1186535397 X:10341996-10342018 AGACTGATGTATGTGATTCAAGG - Intergenic
1186595098 X:10972580-10972602 AGGTTTATGTAAGTGCTAAAGGG - Intergenic
1189014579 X:37083616-37083638 AGGTTGGTTTATGAGCTTTAAGG + Intergenic
1192421903 X:71040219-71040241 ACTTTGATATATGTTCTTCAGGG + Intergenic
1193472403 X:81923300-81923322 AGGCTAATGAATATGCTTCAGGG + Intergenic
1193550365 X:82884864-82884886 AGGTTGATTTAAGTTCTTTATGG - Intergenic
1199148162 X:144396610-144396632 GGGATGATGTTGGTGCTTCAAGG - Intergenic