ID: 967173967

View in Genome Browser
Species Human (GRCh38)
Location 3:186846016-186846038
Sequence ATGAGGAAACTGACAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967173967_967173971 10 Left 967173967 3:186846016-186846038 CCTTAATCTGTCAGTTTCCTCAT 0: 1
1: 1
2: 3
3: 43
4: 350
Right 967173971 3:186846049-186846071 GGGCTCATTTCCTTCCTTCATGG 0: 1
1: 0
2: 1
3: 27
4: 287
967173967_967173969 -10 Left 967173967 3:186846016-186846038 CCTTAATCTGTCAGTTTCCTCAT 0: 1
1: 1
2: 3
3: 43
4: 350
Right 967173969 3:186846029-186846051 GTTTCCTCATCTCTGAAGTTGGG 0: 1
1: 3
2: 59
3: 637
4: 3291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967173967 Original CRISPR ATGAGGAAACTGACAGATTA AGG (reversed) Intronic
900095334 1:937886-937908 CTGATAAAAATGACAGATTAAGG + Intronic
901628273 1:10635719-10635741 ATGAGGAAACAGGCAGACTTGGG - Intergenic
902297439 1:15477673-15477695 TTGAGGAAACAGAAAGATTGGGG - Intronic
903689282 1:25159859-25159881 ATGAGGAAACTGACATACTCAGG + Intergenic
904824971 1:33268464-33268486 ATGAGCAAACAGACAGAACATGG + Intronic
905270921 1:36786913-36786935 ATGAGGAAACTGAAAGCCTAGGG + Intergenic
906799097 1:48720529-48720551 ATGAGGAAACTGACTTAATGAGG - Intronic
907255089 1:53173176-53173198 ATGAGGAAACTGAGACTTCAAGG - Intergenic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
908261913 1:62345666-62345688 ATGAGGAAACTGAAGGTCTAGGG - Intergenic
908285805 1:62599017-62599039 GTGAGGAAACTGAGAGATAAAGG - Intronic
908395251 1:63719505-63719527 ATAAGGAAACAGACACATGAGGG - Intergenic
908848449 1:68349013-68349035 ATATGGAAACTGAAAAATTAAGG - Intergenic
908899851 1:68944140-68944162 ATGAGGAAACTGGAACATTAGGG - Intergenic
910083990 1:83376249-83376271 ATGTGGAAAATTACAGATTGGGG + Intergenic
910480266 1:87651010-87651032 GTAATGAAACTGACAGATAAGGG + Intergenic
910745032 1:90564290-90564312 TTCTGGAGACTGACAGATTATGG - Intergenic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
911409908 1:97490164-97490186 ATGATGACAATGACAGCTTATGG - Intronic
912054200 1:105574756-105574778 ATGAGAATAATCACAGATTAAGG - Intergenic
912194689 1:107383826-107383848 TTGAGGAAACAGAAAGTTTAGGG - Intronic
912198129 1:107424126-107424148 ATTAGGAAATTGAGGGATTAGGG + Intronic
912968352 1:114257193-114257215 ATGATGGAACAGAAAGATTAAGG - Intergenic
913613620 1:120533482-120533504 ATGAGAACACTGAAAGTTTAGGG - Intergenic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
914576647 1:148977399-148977421 ATGAGAACACTGAAAGTTTAGGG + Intronic
914696069 1:150081297-150081319 AAAAGGTAACTGACAGAATATGG - Intronic
914750570 1:150532285-150532307 ACGAGGGAACTGACAGAGGACGG - Intergenic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
916145854 1:161738827-161738849 ATGAGTAGACAGGCAGATTAGGG - Intergenic
917689372 1:177451604-177451626 CTGAAGAGACTGACAGATCAAGG + Intergenic
918889810 1:190252462-190252484 ATGAGGATATAGAAAGATTAAGG + Intronic
919974286 1:202600708-202600730 CTGAGGATGCTGACAGATGAGGG + Intronic
921327892 1:214005818-214005840 ATGAATAAAGTGACAGATTCAGG + Intronic
923032419 1:230260047-230260069 ATGACAAAATTGACAGTTTAAGG - Intronic
923847676 1:237754474-237754496 ATCAGGAAACTCACAGAAGATGG - Intronic
924262717 1:242248754-242248776 TTAAGGAAACTGATAAATTATGG - Intronic
924501349 1:244641675-244641697 ATGAGGAAACTGGCACATAGAGG + Intergenic
924686949 1:246302706-246302728 ATGTGGAAACTGACCCAATATGG + Intronic
1064240980 10:13628291-13628313 ATGTGGAATCTGTTAGATTATGG + Intronic
1066725515 10:38388176-38388198 TTAAGGAAACTGATAAATTATGG + Intergenic
1067139128 10:43641342-43641364 ATGAGAAAAATGAAACATTATGG - Intergenic
1067537122 10:47120999-47121021 ATGAGGAAAATGACATAATTTGG - Intergenic
1068722440 10:60261105-60261127 ATGAGGAAACTGACAGACACAGG + Intronic
1068735547 10:60409928-60409950 ATGATGAAGCTGAGAGACTAGGG - Intronic
1068893893 10:62178907-62178929 ATGAGGAAACTGATACTTGAGGG - Intergenic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1069654121 10:70075279-70075301 ATGAGGAAATTGACATCTTTGGG + Intronic
1070055642 10:72932180-72932202 ATAAGGAAACAGAGAGGTTAAGG - Intronic
1071269752 10:83996090-83996112 AAGAGGAAGCTGACAGGTTGTGG - Intergenic
1072220007 10:93318873-93318895 AGGAGGAAGCTGACAGAATGTGG + Intronic
1072543855 10:96419162-96419184 ATTAGGAAACTGAGACATTGAGG - Intronic
1072747814 10:97953794-97953816 AGGAGGAAAATAACACATTATGG - Intronic
1073712762 10:106063745-106063767 ATAAAGAAACTGAAAAATTAAGG - Intergenic
1073790881 10:106939112-106939134 TCTAGGAAACTGACAGATAATGG + Intronic
1073831698 10:107391645-107391667 ATTAGGAAACTGAAAAATTATGG + Intergenic
1073836208 10:107445753-107445775 ATGAGGGAAATGACAGAGCATGG - Intergenic
1074949909 10:118323051-118323073 CTGAGGAAACTGACTGACTTGGG + Intronic
1075163450 10:120044608-120044630 AAGAGGAAATTGACAAAGTATGG - Intergenic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1077844549 11:6011555-6011577 ATGTGGCAAATGACAGATGATGG + Intergenic
1078366747 11:10712929-10712951 ATGAGGAAACTGACACCTAGAGG + Intergenic
1079448921 11:20582358-20582380 ATGAGGAAACTGAAAAATAATGG + Intergenic
1079576449 11:22009200-22009222 ATGAAGAAACTGACGCATTTGGG - Intergenic
1079598271 11:22280268-22280290 ATAAGAAAACTCACACATTAAGG + Exonic
1081237404 11:40661973-40661995 ATGAGGAAGCTGTCATATTAGGG + Intronic
1081943866 11:46970683-46970705 AAAAGGAAAATGACAGAATAAGG + Intronic
1082014410 11:47473769-47473791 ATGATGAAACTCACTGATTTTGG - Intronic
1082027330 11:47582394-47582416 AGAAGGATCCTGACAGATTATGG + Exonic
1083313721 11:61801202-61801224 ATGAGGAAAGACACAGATTTCGG - Exonic
1085484565 11:76851047-76851069 ATGATGAAACTGACACAGTGAGG - Intergenic
1085720317 11:78906689-78906711 AAGAGGAAAAGGACAGATCAAGG - Intronic
1085720603 11:78909385-78909407 ATGAGGAAACTGACACATAAAGG + Intronic
1085842033 11:80022975-80022997 ATGAGAAAACCTACAGATTGGGG + Intergenic
1086136981 11:83451480-83451502 ATCAGGAGGCTGACAGATTCAGG + Intergenic
1086400347 11:86456463-86456485 ATGAGGAAATTGACAGAGAAAGG + Intronic
1086785508 11:90965493-90965515 ATGCAGAAAATAACAGATTAGGG + Intergenic
1087044112 11:93830122-93830144 ATAAGGAAGCTGACAGAGTGTGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087966239 11:104419643-104419665 ATGAGAAAACTGAACGATCAAGG + Intergenic
1088560898 11:111115233-111115255 ATAAGGAAACTGAGACCTTATGG + Intergenic
1088923963 11:114281933-114281955 ATGAGGAAATTGACAAAGGAAGG + Intronic
1089110239 11:116050018-116050040 CTGAGGAAACTGACAGTCTGGGG - Intergenic
1089170879 11:116510699-116510721 ATGAGGAAATTGGCAGCTTCAGG - Intergenic
1090120367 11:124020611-124020633 ATGTGGAAAGTGACAAATTGGGG + Intergenic
1090120931 11:124027208-124027230 ATGTGGAAAGTGACAAATTGGGG + Intergenic
1091896801 12:4111489-4111511 GTGAGGAAACTGAGAGAAAAAGG - Intergenic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093064352 12:14640992-14641014 ATGTGGTTACAGACAGATTAGGG + Intronic
1098847442 12:75555083-75555105 ATGAGGAAACCGAGACATTCAGG + Intergenic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1101295198 12:103415945-103415967 ATGAGGAAACCTACAGAAAAAGG - Intronic
1101334725 12:103786325-103786347 ATGTGGAAACAGAAAGATTCTGG + Intronic
1101406717 12:104435217-104435239 CTGAGGAAGCTCACAGATCACGG - Intergenic
1101418614 12:104530508-104530530 GTGAGGACATTGACAGTTTAGGG + Intronic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1102272353 12:111548338-111548360 ATGAGGAAACAGGCATATTTAGG - Intronic
1102447819 12:113017079-113017101 ATGAGGAAATTGAGAGGTTGGGG - Intergenic
1102559937 12:113754759-113754781 ATGGGGAAAGTGACAGATTTGGG + Intergenic
1102634964 12:114314919-114314941 TTGAGGAAACTGGCAGATCCAGG + Intergenic
1103106388 12:118230062-118230084 ATGAGGAAACTGAGGCATTGGGG + Intronic
1103249034 12:119484195-119484217 ATGAGGAAACTGAGGCATAAAGG - Intronic
1103455351 12:121060784-121060806 AAGAGCAAACTGACAGTTTGTGG + Intergenic
1105386897 13:19938676-19938698 ATGAAGAAACTGAAATGTTAGGG + Intergenic
1106961886 13:35008674-35008696 ATGAGGAAATTGGGAGATGAGGG - Intronic
1109580952 13:64333711-64333733 GAGAGGAAACAGAGAGATTAAGG - Intergenic
1109956502 13:69574451-69574473 ATGAAGAAACTGAGACATTGGGG + Intergenic
1110037782 13:70711127-70711149 ATTAGGAAACAGAGAGATGATGG - Intergenic
1110202764 13:72872097-72872119 ATGAGGAAACTGAGACATAGAGG - Intronic
1110600126 13:77363535-77363557 ATGAGGAAAATTACAGACTGTGG - Intergenic
1111157169 13:84342979-84343001 ATGAGGCAACTGAGAAAGTAGGG - Intergenic
1111941020 13:94606933-94606955 ATGAGCAAACTGGCAGAGAAAGG - Intronic
1112221738 13:97498135-97498157 ATGAGGACCCTGACAGATTTGGG - Intergenic
1114182808 14:20380025-20380047 ATGAGGAAACTGCCAGAGACAGG + Exonic
1115706426 14:36003512-36003534 ATGAGGAAACTGACTTACAAAGG - Intergenic
1115810506 14:37101929-37101951 ATGAGGAAACTGAAACATGAGGG - Intronic
1115913717 14:38285995-38286017 ATGCTGAAACTGTGAGATTAGGG + Intergenic
1116000710 14:39239822-39239844 ATTTGGAAACTGACAGACTGTGG - Intronic
1116180876 14:41532578-41532600 ATGAGGAAAATAACAGCATATGG - Intergenic
1117592573 14:57287934-57287956 CTGATGGAACTGAGAGATTAGGG + Intronic
1117830835 14:59748063-59748085 ATGAGGAAACTGAGAAACAAAGG + Intronic
1120933467 14:89871623-89871645 ATGGGAAAACTGGCAGATTTGGG - Intronic
1120973257 14:90227268-90227290 ATGAGGAAACTGAGGCATAAGGG + Intergenic
1121705154 14:95987397-95987419 ATGATGAAACTGAGATAATATGG - Intergenic
1121895405 14:97642267-97642289 ATGAGGAAACTCAGAAATGAGGG - Intergenic
1124012736 15:25851698-25851720 ATGAGGAAATGGACAGCTTTTGG - Intronic
1124030058 15:26002251-26002273 ATGAGGAAACGCACAGACTTTGG - Intergenic
1125559659 15:40618441-40618463 ATGATGAGACTGAAAGGTTAGGG - Intronic
1125580851 15:40784532-40784554 ATGAGGAAACTGTGACATAAGGG + Intronic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126503468 15:49375065-49375087 ATTGGCAAACTGAAAGATTAAGG + Intronic
1128340167 15:66817009-66817031 ATGAGGAAACTGACAGGCAGAGG + Intergenic
1128383928 15:67133828-67133850 ATGAGGCAACTGAGAGATTCAGG + Intronic
1131664106 15:94551653-94551675 ATGAGGAAACTAAAATATTAAGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134197193 16:12168364-12168386 GTGAGGAAACTGGAAGCTTAAGG + Intronic
1135635808 16:24074385-24074407 ATGTGGAACCTGACAGCTGAGGG - Intronic
1135651633 16:24211466-24211488 AAGAGGAAACTGAAACTTTAAGG + Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1137870956 16:51949799-51949821 ATGAGGAAACTGAGAATCTAAGG + Intergenic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1141354278 16:83329112-83329134 ATGAGTTAACTCACAGATTCCGG + Intronic
1143322951 17:6079922-6079944 ATGAGGAAACTGGCAAAAGAAGG - Intronic
1146197411 17:30825013-30825035 ATGAGGAAATTGAGGGATAAAGG + Intergenic
1148212959 17:45819297-45819319 AGGAGGAAGCTGACAGGTTTCGG + Intronic
1148364724 17:47045879-47045901 ATGAGGAAACAGACAAATCCGGG - Intronic
1149444055 17:56699928-56699950 ATGAGGAAACTGAGGCATAAAGG - Intergenic
1149804218 17:59599793-59599815 ATGAGAAAACTGGGAGATGATGG - Intronic
1149842276 17:59975692-59975714 ATGAGAAAACTGGGAGATGATGG + Intergenic
1150120469 17:62597192-62597214 AAGATAAAACAGACAGATTAGGG - Intronic
1150301327 17:64049447-64049469 ATGAGGACACTGACAGCATGGGG + Intronic
1150812765 17:68369656-68369678 AAAAGGAGACTGAGAGATTAAGG - Intronic
1153583405 18:6598005-6598027 AGGAGGAAACTGAGAGATGAAGG + Intergenic
1154156095 18:11945376-11945398 ATGTGGACACTGAAAGAGTAAGG - Intergenic
1154301347 18:13195500-13195522 AGAAGGAAACTGACAGAGAAAGG + Intergenic
1155458397 18:26047081-26047103 ATGAGGAAACAGACATCCTATGG - Intronic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156129379 18:33951950-33951972 ATGTAGAACCAGACAGATTAGGG - Intronic
1156823373 18:41399639-41399661 ATGATGAAATTGGCAGACTAAGG + Intergenic
1157327142 18:46677592-46677614 ATGAGGAAACTGAGACATTGAGG + Intronic
1157449781 18:47776711-47776733 AGCAGGAACCTGACAGAATATGG - Intergenic
1158530160 18:58253362-58253384 AAGAGAAAACTAACAGATTTTGG + Intronic
1158980877 18:62760370-62760392 ATGAGAAAACTTACAGATCTCGG - Intronic
1159212257 18:65340250-65340272 ATGAGGAAACTAATAGAACATGG - Intergenic
1161898747 19:7101886-7101908 ATGAGGAAACTGAAACACGAAGG + Intergenic
1163481422 19:17558847-17558869 ATGAGGAAACTGACATGGAAAGG + Intronic
1163526373 19:17824041-17824063 AGAAGGAAACTGAGAGATGAAGG - Intergenic
1164878701 19:31712687-31712709 AAGAGGTCACAGACAGATTAGGG - Intergenic
1166562230 19:43740550-43740572 ATGAGGAAACTGATGGAAAAAGG - Intronic
1167616572 19:50537723-50537745 AAGAAGAAACTGACAAAGTATGG + Intronic
1168352030 19:55681329-55681351 ATGAGGGAACTGAGACATAAAGG + Intronic
925360078 2:3272543-3272565 ATGAGGAAACTGCCGGTTGATGG + Intronic
925868023 2:8245926-8245948 ACAAGGAAACTGCCAGATCATGG + Intergenic
927364371 2:22276882-22276904 AGAAGGAAACAGACAAATTACGG + Intergenic
928919991 2:36516856-36516878 ATGAGGAAACTGAGAGCTCAGGG - Intronic
929245841 2:39702520-39702542 ATGAGAACAATGACAGATAAAGG - Intronic
929759774 2:44797504-44797526 ATGAGGAAACAGAAAGACAAAGG + Intergenic
929972201 2:46591750-46591772 ATGAGGAAACTGACACCTAGAGG - Intronic
931365081 2:61612252-61612274 ATGAGGAAATCCAGAGATTAGGG - Intergenic
931725301 2:65104151-65104173 ATGCTGAAGCTGACAGATAAAGG - Intronic
931774041 2:65524556-65524578 ATGAGAAAAATGAAAGAGTAGGG + Intergenic
933199196 2:79429316-79429338 ATGAGGAAACTGAGGTTTTAAGG - Intronic
933251179 2:80030320-80030342 ATGATGAAACTGAAAGTTTGTGG + Intronic
933683025 2:85119790-85119812 TTGGTGAGACTGACAGATTAAGG + Intergenic
935601879 2:104930464-104930486 ATAATGAAAGTGATAGATTAGGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
938147489 2:128848954-128848976 ATTAAAAAACTGAAAGATTAGGG + Intergenic
938926634 2:136049078-136049100 TTGAAGAAACTGACAGCTGAAGG + Intergenic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
939058404 2:137391213-137391235 ATGAGAAAACTGAGAGAAAATGG - Intronic
939590915 2:144062365-144062387 ATGAGGAAACTGAGGCATAAAGG + Intronic
942090600 2:172486504-172486526 ATGACGAAACAGAGAGCTTAAGG - Intronic
942137607 2:172943407-172943429 ATGAGGAAACTGGCAGCTCTGGG - Intronic
942270362 2:174268271-174268293 ATGAGGAAGTTGACAGAATAAGG - Intergenic
942311315 2:174659642-174659664 ATGAGGAAACTGAGAACTTGGGG + Intronic
943743654 2:191438292-191438314 CTGAGGAAACTGACAGGCTAAGG - Intergenic
944818238 2:203401501-203401523 ATTAGGAAACTGATGGATTATGG + Intronic
945081846 2:206093942-206093964 ATGAGGAAACTGAGAGGGTAAGG - Intergenic
945771709 2:214051402-214051424 ATGAGGAAATGGCCAGATTTAGG + Intronic
947104725 2:226656927-226656949 AAGAGGAAACTGTCAGTTCATGG + Intergenic
947430842 2:230026252-230026274 AAGATGAAACTGACATATTAAGG + Intergenic
947743477 2:232495882-232495904 ATGACCACACTGAGAGATTAGGG + Intergenic
1169784458 20:9344151-9344173 AGGAGGAAAGAGAGAGATTAAGG - Intronic
1170033340 20:11965458-11965480 ATGAGGAAACTAAAAAGTTAAGG + Intergenic
1170776425 20:19378751-19378773 ATGAGAAAACAGACAGATGAAGG - Intronic
1172156384 20:32828199-32828221 ATGAGGAAACTAATAGAAAATGG - Intronic
1172293891 20:33794483-33794505 ATGAGGCAACAGGCACATTAAGG + Intergenic
1173522772 20:43711750-43711772 TTGAGGAAACTGACAAGATAAGG + Intronic
1174116139 20:48227668-48227690 ATGAGGAAACTGAGACACAAGGG + Intergenic
1174531796 20:51220216-51220238 AAGAGGAAACTTACATCTTAGGG + Intergenic
1175674574 20:60935665-60935687 GTGAGGATACTGAAAAATTATGG - Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176936503 21:14874152-14874174 AGGAGAAAACAGACAGTTTATGG - Intergenic
1177308722 21:19357383-19357405 ATGAGAAAACTGGCAGATGAGGG - Intergenic
1178597116 21:33964223-33964245 ATGAGGATACTGAGAAGTTAAGG + Intergenic
1178920566 21:36735741-36735763 GTGAGGATACGGACATATTAAGG - Intronic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1183669066 22:39261592-39261614 ATGAGGAAACAGAGATATCAAGG + Intergenic
1185241232 22:49748785-49748807 AGGAGGAAACTGACAGGTCCAGG + Intergenic
949319314 3:2791239-2791261 ATGAGGAAACTGACTGGGCATGG + Intronic
949323524 3:2838839-2838861 GGGAGGAAACTCACAGCTTACGG - Intronic
951873324 3:27391754-27391776 ATGAGGAAACTCCCATATAAAGG + Exonic
951989981 3:28665712-28665734 ACGAGGTAACTGACAGAATAAGG - Intergenic
952025294 3:29073330-29073352 ATGAGGAAAGAGACACATTGAGG - Intergenic
952716110 3:36482557-36482579 CTCAGGAAAATGACTGATTAAGG - Intronic
954561232 3:51558268-51558290 AGGAGCCAACTGACAGATAAGGG - Intronic
955457657 3:59141575-59141597 CTGAGGAAACTGACAGAATTAGG + Intergenic
956326538 3:68059366-68059388 ATGAGGAAACTGAGACAGAAAGG + Intronic
956452711 3:69390301-69390323 GTGGGTAAACTGACAGATCATGG + Intronic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
956814733 3:72897702-72897724 ATGAGGAAACTGAGGGCTAAAGG + Intronic
957538298 3:81534199-81534221 ATGAAAAAAATGACAGATTCAGG - Intronic
958679008 3:97301654-97301676 GTGAGAAAACTGCCAGATTATGG - Intronic
958732722 3:97975766-97975788 ATAAGGAAACAGACACATCAAGG + Intergenic
959168020 3:102805145-102805167 ATGAGGAAACTGAGGGAGAAAGG + Intergenic
960497184 3:118388687-118388709 ATGAGGACACTAGCAGATTGTGG + Intergenic
960822063 3:121744949-121744971 ATGAGGAAACTGACGCTTTAAGG - Intronic
962098397 3:132315942-132315964 ATGATGGAACTGACAGGTTGGGG + Intergenic
962424996 3:135261894-135261916 ATGAGGAAACTGAGAGACAAAGG + Intergenic
963027034 3:140930265-140930287 ATGAGGAAACTGAGAGGTCAGGG - Intergenic
963318106 3:143782962-143782984 ATGATGGAACTGACAGAATATGG - Intronic
964361361 3:155900613-155900635 ATCAGGAAACTGACATAATGGGG - Intronic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
964589640 3:158346154-158346176 AAGAGGAAATTGGCAGAGTATGG + Intronic
965141391 3:164840408-164840430 ATTAAGAAACAGAGAGATTAAGG + Intergenic
966181487 3:177192848-177192870 ATGAAGAAACAAACACATTAGGG + Intronic
966494803 3:180567899-180567921 ATGGGTAACCTGACAGATTTAGG + Intergenic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
967174246 3:186848417-186848439 ATGAGGAAACTGAGAGATTAAGG + Intronic
969984228 4:11190535-11190557 ATGAGGAAACTGACGACTGAGGG + Intergenic
970440371 4:16076507-16076529 ATGAGGAAACTGACACAGAGAGG + Intronic
970891170 4:21046223-21046245 ATGAGGAAACTCATAGAGGATGG + Intronic
971165980 4:24184251-24184273 ATTAGGAAACTGACTTCTTAAGG + Intergenic
971566428 4:28148489-28148511 ATTCAGCAACTGACAGATTAAGG + Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
972028713 4:34423403-34423425 AAAAGGAAATTGACATATTAAGG - Intergenic
972333138 4:38081767-38081789 ATGAGGAAACTGACACAGAGGGG + Intronic
972688373 4:41372839-41372861 ATGAGGAAACTGAGACTTGAGGG + Intronic
973926954 4:55748472-55748494 ATGAGAATACTAACATATTAAGG + Intergenic
975025084 4:69538241-69538263 ATGAGAAAACTGTGAGACTATGG - Intergenic
975311666 4:72910556-72910578 ATGAGGACAGTCACAAATTAGGG + Intergenic
976766703 4:88605535-88605557 ATGAGTAAACAGACAGAATATGG - Intronic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978697231 4:111596866-111596888 ATGAGGAAAGTGAGAGATGACGG + Intergenic
978798515 4:112732223-112732245 ATGTGGGAATTGACAGAGTAGGG + Intergenic
979040442 4:115785153-115785175 ATGAAGAAATTGACATATAAAGG - Intergenic
979185064 4:117778548-117778570 ATTATGAAACTGACAGTTTTTGG + Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979718688 4:123872318-123872340 ATGAAGAAAGTGGCAGGTTAAGG - Intergenic
980712120 4:136582705-136582727 AAGATTAAAATGACAGATTAGGG - Intergenic
981030513 4:140120680-140120702 ATGAGGAAAAAAAAAGATTAAGG - Intronic
981260494 4:142712886-142712908 ATGAGGAAAATAAGACATTAAGG + Intronic
981463774 4:145041555-145041577 CTTAGAAAACTGACACATTAAGG + Intronic
981525554 4:145703540-145703562 AAAAGAAAACTGACAGAATAAGG - Intronic
982164721 4:152604262-152604284 CCTAGGAAACTGACAGAGTAGGG + Intergenic
983100036 4:163614349-163614371 CTGAGGAAACTGAAAAATTGGGG + Intronic
984437550 4:179724590-179724612 ATGAGGAACATGAAAGAATATGG - Intergenic
984555957 4:181214024-181214046 AAGAGGAGACTTACAGATAAAGG - Intergenic
985001006 4:185482829-185482851 ATGAGGAAACTGAGACATAGAGG - Intergenic
985652843 5:1114977-1114999 TTGTGGAAACTGACAAATGAGGG - Intergenic
986632320 5:9785631-9785653 TTGAGGACACTGACATTTTAGGG + Intergenic
987352925 5:17037142-17037164 CTTAGGACATTGACAGATTAGGG + Intergenic
987764004 5:22201840-22201862 ATAAGGCAAGTGACAGATGAAGG + Intronic
988089745 5:26521671-26521693 ATGAGAAATATGAGAGATTATGG + Intergenic
988332614 5:29862024-29862046 ATGAGAAAACTGACATTATAAGG + Intergenic
988360755 5:30233453-30233475 ATGAGTGAACTGGCATATTAAGG - Intergenic
988428056 5:31087111-31087133 ATGAGGAAAGTGGCAGATCTAGG - Intergenic
988661613 5:33276361-33276383 ATGAGGAAACTGTCACAGTGAGG + Intergenic
990754583 5:59055001-59055023 CTGAGAAAACTCACACATTATGG - Intronic
991254386 5:64598271-64598293 ATGAGACAACTGAAAGATGAGGG - Intronic
991898728 5:71434918-71434940 ATAAGGCAAGTGACAGATGAAGG + Intergenic
992525626 5:77607406-77607428 ATGAGGACACTGAAAGATACAGG + Intronic
992629196 5:78664676-78664698 ATGAGGAAATTCTTAGATTATGG - Intronic
992652518 5:78873868-78873890 CTGAGAAAACTGACACAGTAGGG + Intronic
992765524 5:79995462-79995484 ATGAGGAATATGACTGATAAAGG + Intronic
993756165 5:91733120-91733142 ATGAGGAAACTGAGACATAGAGG + Intergenic
994057492 5:95434638-95434660 ATGAAGAAATTGACAAATTGTGG - Intronic
994133319 5:96256913-96256935 TTGATGACACTGGCAGATTATGG + Intergenic
994190394 5:96862779-96862801 ATGAGGCAATTGAGAGATTAAGG + Intronic
994520882 5:100833463-100833485 AGTAGGAAACTTACAGATGATGG + Intronic
995447915 5:112266963-112266985 ATGAGAAAACTGATAGACTCAGG + Intronic
995933567 5:117481853-117481875 ATGAGGAAACTGAGAGGTAGAGG + Intergenic
996595184 5:125192695-125192717 CTAATGAAACTGACAGCTTATGG + Intergenic
996982220 5:129512647-129512669 CACAGGAAACTGACAGATTGGGG + Intronic
998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG + Intronic
998561429 5:143175791-143175813 ATGAGGAAATTTAAAAATTAAGG - Intronic
998612105 5:143700400-143700422 ATGAGAAAACTGACAGTCGAAGG + Intergenic
998676963 5:144420298-144420320 AAGAGGAAAGAGGCAGATTATGG + Intronic
998727322 5:145032362-145032384 ATAAGGAAAGTGGCAGATTGAGG - Intergenic
1000047673 5:157535014-157535036 ATGAGGAAACTGAGAGGAGAAGG - Intronic
1002018231 5:176343315-176343337 ATGAGGAGACTGAGAAATGATGG + Intronic
1003529614 6:6927005-6927027 ATGAGGAAGATGACAGAGAAAGG + Intergenic
1006339778 6:33440507-33440529 CAGAGGGAACAGACAGATTAGGG - Intronic
1006565058 6:34949001-34949023 ATGAGGAAACAGACACAGTCAGG - Intronic
1007475689 6:42118433-42118455 ATCAGGAAAATGACAGACTTAGG + Intronic
1007656460 6:43454111-43454133 ATGAGGAAATGGAAAGATAAAGG - Intronic
1009698701 6:67145561-67145583 ATCAGGGTACTGACAGATTTGGG + Intergenic
1010022869 6:71181565-71181587 CTGAGGAACCTCACAGATAAAGG + Intergenic
1011034522 6:82958896-82958918 ATGAGGAAAATGACAGGACAAGG + Intronic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011512102 6:88112859-88112881 ATGAGGAAACTGAGGAATAAAGG + Intergenic
1012090713 6:94892097-94892119 CTGAGGAAATTTCCAGATTAAGG - Intergenic
1012498943 6:99867243-99867265 ATGAGGAACTTGACAGAAGAGGG - Intergenic
1012637362 6:101561294-101561316 ATGAGGAAATTTACAGAATTGGG + Intronic
1015227310 6:130872665-130872687 ATGAGAATTCTGACAGATTCTGG + Intronic
1016090897 6:139977614-139977636 ATGAGGAAACAGACACAAAAAGG - Intergenic
1016268208 6:142257030-142257052 ATGAGTAAAGTGATAGAGTAGGG + Intergenic
1018417497 6:163613733-163613755 ATGGGAACACTGAGAGATTATGG - Intergenic
1019035374 6:169051407-169051429 AGGAGGAAACGGGGAGATTATGG - Intergenic
1019036411 6:169063298-169063320 ATGAGGAAACTCACAGGCCAAGG + Intergenic
1019053954 6:169206601-169206623 TTCACCAAACTGACAGATTAAGG + Intergenic
1020857168 7:13443792-13443814 GAGAGGAAACTGACATAGTAGGG + Intergenic
1020983581 7:15103499-15103521 ATGAGGAAAAATACTGATTAAGG + Intergenic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1024428472 7:49258037-49258059 ATGAGGAAAATGAGAGAAAAGGG + Intergenic
1025624197 7:63204220-63204242 ATGAGGACACTAACAGACTGAGG + Intergenic
1025933721 7:66017051-66017073 CAGAGGAAAATGACACATTAGGG + Intergenic
1025950099 7:66138427-66138449 CAGAGGAAAATGACACATTAGGG - Intronic
1026290551 7:69002078-69002100 ATGAGGTGACTGTCAGATGATGG + Intergenic
1028253340 7:88561451-88561473 ATTAGCAAACTCACTGATTATGG + Intergenic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028938925 7:96497831-96497853 ATAAGGGAACTAACAGATGACGG + Intronic
1029528541 7:101110141-101110163 ATGAGGAAACTGACAGATAGAGG - Intergenic
1030436415 7:109527457-109527479 ATGATGAAACTAACAGAAAAGGG - Intergenic
1030648269 7:112088810-112088832 ATGAGGAAACTGAGGGACAAAGG - Intronic
1031277058 7:119738950-119738972 GTAAGGAAACTTACAGTTTAGGG + Intergenic
1031514251 7:122682782-122682804 ATGAGGAAACTGACCCAGAATGG - Intronic
1032216231 7:129959471-129959493 ATGAGGAAACTGAGGCATAAAGG - Intergenic
1032840733 7:135711546-135711568 ATGAGGAAACTGGGGGTTTAGGG + Intronic
1035291884 7:157844493-157844515 CTGAGGAAACTGCCAGGTGAGGG + Intronic
1036495372 8:9265526-9265548 ATGAGAAAACTGAGAGGTTAGGG - Intergenic
1037434321 8:18846796-18846818 AAGAGGGAAATTACAGATTATGG + Intronic
1037544186 8:19901866-19901888 AAGAGGAAACTGCCACAGTAGGG + Intronic
1037640658 8:20739390-20739412 ATGAGGAAACTGAGTGTCTAAGG - Intergenic
1038463389 8:27736394-27736416 GTCAGGAAACTGACAACTTAAGG - Intronic
1041220849 8:55649350-55649372 ATGTGGAAACTTAAAGATAATGG - Intergenic
1041497706 8:58505165-58505187 AAGAGGAAACTAACAGGTTGTGG - Intergenic
1042573314 8:70191083-70191105 ATGATGAAGCTGAAAGTTTATGG - Intronic
1044035010 8:87290923-87290945 ATAAGCAAACAGACACATTATGG - Intronic
1047020598 8:120771409-120771431 ATGAAGAAAAAGACAGATTTAGG + Intronic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1047686435 8:127309339-127309361 ATGAAGAAACTGACATAACAGGG - Intergenic
1048821251 8:138382586-138382608 ATGAGAAAACTGAGAAATAAAGG - Intronic
1050412056 9:5376402-5376424 ATAAGGAAACAGAGAGATTAAGG - Intronic
1050623700 9:7481323-7481345 ATGAGGAAACTGAGGCATAATGG - Intergenic
1050642898 9:7687237-7687259 ATGAGAAAATTGACAGACAATGG + Intergenic
1051042351 9:12826718-12826740 ATTAGGAAACGGACATATTTGGG - Intergenic
1052150886 9:25114080-25114102 ATGAGGAAACTCATAGATAAAGG - Intergenic
1055553339 9:77451217-77451239 ATGAGGAAACTGAGGGCTTAGGG - Intronic
1055849884 9:80613501-80613523 ATAAGAAAACTGAAAGATGATGG - Intergenic
1056121824 9:83495841-83495863 ATGAGTAAATTCACAAATTATGG + Intronic
1057575574 9:96239698-96239720 AGGAGGAAATTGGCAGATGATGG + Intronic
1058382553 9:104393718-104393740 ATGCAGAAACTGAGAGGTTAAGG + Intergenic
1058564516 9:106267823-106267845 ATGAGGAAATTGGCATAATATGG - Intergenic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1059721673 9:116965887-116965909 ATGAGGAAGCTGACATTCTAAGG - Intronic
1059800312 9:117743536-117743558 ATGAGGAAACTGAGGCATTTAGG - Intergenic
1059875416 9:118629094-118629116 AGGAGGGAACTGACAGATGCTGG + Intergenic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1061049342 9:128185421-128185443 ATGAGGAAACTGAGGCATAAAGG + Intronic
1061829976 9:133285535-133285557 ATGAGGAAATTGAAAGACTGAGG - Intergenic
1062266778 9:135690168-135690190 CTCAGGAAACTGACAAATTGTGG - Intergenic
1186590679 X:10926788-10926810 ATGTGGAAACTGCCAGTTAAAGG - Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1187277815 X:17831773-17831795 ATAAGGAAATAGACAGATTTAGG - Intronic
1189221144 X:39373250-39373272 TTAAGGAAACTGATTGATTAGGG - Intergenic
1189488990 X:41455061-41455083 ATGAGGAAACTGAGAGACAGAGG + Intronic
1190543060 X:51497375-51497397 ATGAGGAAACTGAGACACAAAGG - Intergenic
1192774143 X:74224083-74224105 ATTAGGAAAATGACATAGTAAGG - Intergenic
1192908840 X:75581872-75581894 ATGTGGATACTGACAGACTATGG - Intergenic
1193744840 X:85264792-85264814 ATGAGGAAACAGACAGAAGGGGG - Intronic
1197314236 X:124944899-124944921 CTGAGAAAACTGAGACATTATGG - Intronic
1198184259 X:134237984-134238006 ATTAGGACCCTGACAGATGAAGG + Intronic
1198519983 X:137442618-137442640 ATGAAGATGCTGGCAGATTAGGG - Intergenic
1199139785 X:144296508-144296530 ATGAACTGACTGACAGATTATGG - Intergenic
1199419046 X:147621788-147621810 ATAAGGAAACTGAGAGGTGATGG + Intergenic
1201720090 Y:17087158-17087180 ATGAGGAATCAGACACATTTGGG - Intergenic