ID: 967173990

View in Genome Browser
Species Human (GRCh38)
Location 3:186846181-186846203
Sequence GTAAAAGCAAGGCAGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 424}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967173980_967173990 -4 Left 967173980 3:186846162-186846184 CCCCTCAGCCTTCCCATTTGTAA 0: 1
1: 1
2: 4
3: 30
4: 357
Right 967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG 0: 1
1: 0
2: 1
3: 33
4: 424
967173981_967173990 -5 Left 967173981 3:186846163-186846185 CCCTCAGCCTTCCCATTTGTAAA 0: 1
1: 1
2: 11
3: 74
4: 418
Right 967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG 0: 1
1: 0
2: 1
3: 33
4: 424
967173982_967173990 -6 Left 967173982 3:186846164-186846186 CCTCAGCCTTCCCATTTGTAAAA 0: 1
1: 10
2: 65
3: 689
4: 3700
Right 967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG 0: 1
1: 0
2: 1
3: 33
4: 424
967173978_967173990 6 Left 967173978 3:186846152-186846174 CCTACTCCTTCCCCTCAGCCTTC 0: 1
1: 0
2: 17
3: 131
4: 1674
Right 967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG 0: 1
1: 0
2: 1
3: 33
4: 424
967173979_967173990 0 Left 967173979 3:186846158-186846180 CCTTCCCCTCAGCCTTCCCATTT 0: 1
1: 0
2: 5
3: 81
4: 926
Right 967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG 0: 1
1: 0
2: 1
3: 33
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967173990 Original CRISPR GTAAAAGCAAGGCAGGGGTG AGG Intronic
900986899 1:6078429-6078451 GAAAAAGGAGGGCAGGGGGGCGG + Intronic
901072790 1:6530949-6530971 GTAAAAGCAAGGCCAGGGACTGG - Intronic
901652780 1:10752570-10752592 TTGCAAGCAAGGCAGGGCTGGGG - Intronic
902387016 1:16081863-16081885 GTTTATGCCAGGCAGGGGTGAGG + Intergenic
902570944 1:17346714-17346736 GGCAAAGCAAGGCAGTGGTGGGG - Intronic
902637735 1:17745733-17745755 GTAAATCCAAGGGAGTGGTGTGG + Intergenic
903255066 1:22091819-22091841 TTAAAAGCAAGGCATGCTTGTGG + Exonic
903293949 1:22331982-22332004 ATAAACTCCAGGCAGGGGTGGGG + Intergenic
903959297 1:27046702-27046724 CCAAAGGCAGGGCAGGGGTGGGG - Intergenic
904833867 1:33322533-33322555 TTAAAAAAAAAGCAGGGGTGGGG - Intergenic
905650001 1:39649995-39650017 GTGAGGGAAAGGCAGGGGTGGGG - Intergenic
905823983 1:41015639-41015661 GTTCCAGCAAGTCAGGGGTGGGG + Exonic
905933097 1:41803513-41803535 GGAAAAGCAATGCTGGGGTGTGG - Intronic
906525880 1:46493072-46493094 GAAATGGGAAGGCAGGGGTGGGG - Intergenic
906534237 1:46543014-46543036 GCAAAATCAAGGTGGGGGTGGGG - Intergenic
907161724 1:52375775-52375797 GTAAAACCAAGACAGAGGTTTGG - Intronic
907399395 1:54215576-54215598 TTAGAAGCAAGGCAGGGGCGTGG + Intronic
907564823 1:55425054-55425076 GGAAAAGGAAGGAAGGAGTGGGG - Intergenic
908739969 1:67317494-67317516 GTACAAGAAAGGCAGGAGAGTGG - Intronic
909356936 1:74720238-74720260 ATAACGGCAATGCAGGGGTGAGG - Intronic
909365309 1:74813688-74813710 GAGAAAGCAAGGGATGGGTGAGG + Intergenic
910347695 1:86259332-86259354 GTGAAACCAAGGCAGAGGTTAGG - Intergenic
911087925 1:93994886-93994908 GAACATGCCAGGCAGGGGTGGGG + Intronic
911147343 1:94565477-94565499 GCAAAATCAGGGCATGGGTGGGG - Intergenic
911325322 1:96464445-96464467 GTAAATTCAAAGGAGGGGTGGGG + Intergenic
912507909 1:110168939-110168961 GAAAAAGGAAGGCAGGAATGTGG - Intronic
915084818 1:153378992-153379014 GTAAAAGCAGGCCCTGGGTGGGG + Intergenic
915726949 1:158024831-158024853 TTAGAAGGAAGGGAGGGGTGCGG + Intronic
915950851 1:160189076-160189098 TCAAAAGCATGGCAGGAGTGAGG - Intergenic
916058286 1:161082732-161082754 GAAAAAGCCTGGGAGGGGTGCGG - Intronic
917641814 1:176990220-176990242 GTGAAAGCACAGCAGGGGTGGGG + Intronic
918734643 1:188043602-188043624 GGCACAGCAGGGCAGGGGTGGGG - Intergenic
919495913 1:198267799-198267821 GGAAAAGGCAGGCAGAGGTGAGG - Intronic
919915372 1:202135623-202135645 GTAAAAGCCAGGCATGGTAGGGG - Intronic
920454146 1:206085258-206085280 GTAAAAACACGGCAGGGATAGGG - Intronic
920854874 1:209654133-209654155 GAAAAGGCAGGGCAGGTGTGCGG + Intergenic
920908698 1:210194142-210194164 GTATAAGCAAGAAAGAGGTGGGG - Intergenic
920943193 1:210503296-210503318 CTCCTAGCAAGGCAGGGGTGAGG + Intronic
922001563 1:221483801-221483823 GGAAAAGCAAGGCAGGGCAGGGG + Intergenic
1063928870 10:11009113-11009135 GGAAAGACAAGGCAGTGGTGTGG + Intronic
1063949125 10:11206213-11206235 GTCAAAGCAAGGCAGTGAAGTGG + Intronic
1064311889 10:14219067-14219089 GTAAGAGGAAGGCAAGGGAGAGG + Intronic
1064690847 10:17917147-17917169 GAAAAAGAAAGGAAGGGGAGGGG - Intergenic
1065100526 10:22326178-22326200 GTAGAAGAAAGTCTGGGGTGGGG - Intronic
1065384259 10:25118007-25118029 AAAAAAGCAAGGCAAGTGTGTGG - Intergenic
1065411736 10:25436922-25436944 GCAAAAGCAATGGAGGGATGAGG + Intronic
1066433981 10:35379790-35379812 GTAAAAGGAAAGAAGGGGTAGGG - Intronic
1067742088 10:48903170-48903192 GGAAGAGCAAGGCATGGCTGAGG + Intronic
1067773989 10:49148402-49148424 GGAAAAGCAAGGCAGGAAAGGGG - Intergenic
1067942687 10:50669665-50669687 GGAGAAGCCTGGCAGGGGTGGGG - Intergenic
1068206950 10:53867128-53867150 GTAAAAGGAAAGGAGGGGTAGGG - Intronic
1068253029 10:54469394-54469416 GTTAAAAAAAGGCAGGGATGGGG - Intronic
1068557751 10:58477869-58477891 GTAAAATATAGGCAGTGGTGTGG - Intergenic
1068921882 10:62493426-62493448 GTTAGAGGCAGGCAGGGGTGTGG + Intronic
1069232400 10:66028032-66028054 GTAAAAGAAAGGCAGACTTGGGG - Intronic
1069397284 10:68003461-68003483 GTACAAAAATGGCAGGGGTGGGG - Intronic
1072524460 10:96259241-96259263 CCAATAGCAAGGCAGGGGTGGGG - Intronic
1073255488 10:102148281-102148303 CTAAAAGAAAGGCAGGACTGGGG + Intronic
1073396018 10:103218207-103218229 TTCAAAGTGAGGCAGGGGTGGGG + Intergenic
1074572175 10:114634016-114634038 ATAGTAGCAAGGAAGGGGTGAGG - Intronic
1074941413 10:118239372-118239394 GTGAAACCAAGGGAGGGGGGAGG - Intergenic
1075993739 10:126859806-126859828 GTAAAATCAAGGCAGGGGCAGGG + Intergenic
1076944075 10:133632071-133632093 GTTGAAGCAAGGCAGAGGTCTGG + Intergenic
1077222501 11:1423877-1423899 GTGAAAGCAAGATGGGGGTGGGG - Intronic
1077237455 11:1488551-1488573 GTCCAGGCAAGGCAGTGGTGAGG + Intronic
1078103395 11:8343458-8343480 GTGAAAGCCTGGCAGGGCTGTGG + Intergenic
1078795011 11:14583650-14583672 GTAAAAGCAGGGTAGGAGAGAGG + Intronic
1079098751 11:17527555-17527577 GAGAAACCAAGACAGGGGTGAGG + Intronic
1079116709 11:17644822-17644844 ATATAAGCAAGGGAGGGGTCAGG + Intronic
1080584469 11:33668563-33668585 TTAAAGGCAATGCAGGAGTGTGG + Exonic
1081934651 11:46896356-46896378 GTCATAGCAAGGCAGGGCTTGGG + Intronic
1084717646 11:70883786-70883808 CTGAAAGCCAGGCAGGGCTGGGG + Intronic
1084744966 11:71164163-71164185 GTGAATGCAAGGGAGGGGTGTGG + Intronic
1085711689 11:78834881-78834903 GTACAGCAAAGGCAGGGGTGAGG - Intronic
1086812424 11:91327045-91327067 GTATAAGAAAGTCAGGCGTGAGG - Intergenic
1087584970 11:100107178-100107200 GTGTAAGCAAGGCAGGAGTGAGG - Intronic
1088359578 11:108976656-108976678 GGAATAGATAGGCAGGGGTGAGG + Intergenic
1092042275 12:5395400-5395422 GGAAAAGCAAGTCAGGGGATAGG - Intergenic
1093251594 12:16811445-16811467 GTAAAAGTGTGGGAGGGGTGAGG + Intergenic
1094003839 12:25726176-25726198 CTAGAATCTAGGCAGGGGTGGGG + Intergenic
1094480538 12:30877755-30877777 GGGAAAGCAGGGCAGGGGAGTGG + Intergenic
1095523648 12:43098342-43098364 TTTAAAGGAAGGCAGGGGAGGGG - Intergenic
1095595902 12:43957856-43957878 GTACAAGGAAGGAAGTGGTGGGG + Intronic
1096686643 12:53292522-53292544 GGAAATGCATGGCAGGGGTCAGG - Intronic
1096801971 12:54116438-54116460 GAAAAAGCAAGCCAGAGCTGTGG - Intergenic
1098204869 12:68097953-68097975 ATAAAAGTAAAGCAGGGGTCAGG + Intergenic
1098389301 12:69952238-69952260 GTAAAAGCATTGCTGGAGTGAGG + Intronic
1101245071 12:102877394-102877416 GTAAGAGGAAGGGAGGGGAGTGG + Intronic
1101324050 12:103698752-103698774 GTGAAAGGCAGGCTGGGGTGTGG + Intronic
1101570485 12:105949011-105949033 GCCACAGCAAGGTAGGGGTGAGG - Intergenic
1103478595 12:121236347-121236369 GTGAAAGCAAGCCAGTGTTGGGG + Intergenic
1104807814 12:131600715-131600737 TTAAGGGCAAGGAAGGGGTGGGG - Intergenic
1104950463 12:132437597-132437619 GAAAAAGGAAGGCAGGGAGGAGG + Intergenic
1106168282 13:27268424-27268446 GTAACTGCAAGATAGGGGTGGGG + Intergenic
1106917810 13:34534123-34534145 GGAAAATCAAGGAAGAGGTGGGG - Intergenic
1108736886 13:53293543-53293565 GAAAATCCAAGTCAGGGGTGTGG + Intergenic
1109145778 13:58777520-58777542 GTAAAAGCAAAGGAGGGGCTGGG - Intergenic
1110659642 13:78044918-78044940 GTAAAAACCAAGCAGAGGTGAGG + Intergenic
1113811106 13:113143186-113143208 GTTGGAGGAAGGCAGGGGTGTGG - Intronic
1114133805 14:19823569-19823591 GTATTAGCAAGACAGGTGTGGGG + Intronic
1114426975 14:22631900-22631922 GTCAAAGGCAGGCAGGGGAGTGG - Intergenic
1115204524 14:30887495-30887517 GTAATATTAAGGCTGGGGTGAGG - Intronic
1115288942 14:31748905-31748927 ATAAAAACAAAGCAGGGGTGGGG - Intronic
1116384840 14:44317421-44317443 GTAAAAGCAAAAGAGGGGTGGGG + Intergenic
1117213039 14:53521319-53521341 GTGATAGCAAGGGAGTGGTGTGG - Intergenic
1117532575 14:56673973-56673995 TTAAGAGAAAGGCAGAGGTGAGG + Intronic
1118258316 14:64224468-64224490 GTCGAAGCTGGGCAGGGGTGAGG - Exonic
1118714700 14:68550782-68550804 GTTCTAGAAAGGCAGGGGTGGGG + Intronic
1119518385 14:75266534-75266556 TTAAAAGAGAGGCAGGGTTGGGG - Intronic
1119527759 14:75335858-75335880 GCAAATGCCAGGCAGGGGGGTGG - Intergenic
1122043559 14:99007576-99007598 GTAATAGCCAGGCAGGTGTCTGG - Intergenic
1122289032 14:100669643-100669665 GTTGGAGCAAGGCGGGGGTGGGG - Intergenic
1122411613 14:101528719-101528741 GGGAGAGGAAGGCAGGGGTGTGG + Intergenic
1122496403 14:102159096-102159118 GTAAAAATTAGCCAGGGGTGTGG - Intronic
1122812829 14:104297462-104297484 CTGAAGGCAAAGCAGGGGTGGGG - Intergenic
1124371307 15:29106326-29106348 GTCAATGCCAGGCACGGGTGGGG + Intronic
1124872792 15:33559529-33559551 GTTAAGGCAAGGCAAGGCTGGGG + Intronic
1125266803 15:37891007-37891029 GTAAAAGCAATGCTAGGGTATGG - Intergenic
1128253072 15:66177238-66177260 GTAGATGCATGGCAGGGATGGGG + Intronic
1128525687 15:68410788-68410810 GATAGAGCAAGGGAGGGGTGAGG + Intronic
1128613832 15:69094232-69094254 GAAAAGGGAAGGGAGGGGTGGGG + Intergenic
1128823647 15:70687406-70687428 GGAAAAGCAAGCCAGGGAAGGGG + Intronic
1129297678 15:74608879-74608901 GTCCAAGCCAGGCTGGGGTGGGG - Intronic
1129354914 15:74983817-74983839 GTAGAAGAAAGGCAGGGAGGAGG + Intronic
1129503723 15:76063593-76063615 ATAAAAGCAAGACAGGGAGGAGG - Intronic
1129661788 15:77556729-77556751 ATAAAAGGGAGGCAGGGGAGGGG + Intergenic
1130609666 15:85349519-85349541 GAAAAAGCAGGGCAGTGGGGTGG - Intergenic
1130884518 15:88081908-88081930 GAAAAAGCAAAGCAGGGTTTTGG - Intronic
1131162139 15:90113277-90113299 GCAAAAGGAAGGCCGGGGCGGGG - Intergenic
1131537429 15:93249057-93249079 GTACATGCAAGGCAGAGTTGTGG + Intergenic
1132055438 15:98648147-98648169 GGAAAGGCTAGGCAGGGGAGGGG - Intergenic
1132140242 15:99386475-99386497 GGGAAAGCAAGGGAGGGGAGAGG - Exonic
1132219206 15:100092729-100092751 TTAAAAGAAAGGGTGGGGTGAGG - Intronic
1133098037 16:3460701-3460723 CAGAAAGCAAGGCTGGGGTGTGG + Intronic
1133302157 16:4788980-4789002 GAGACAGTAAGGCAGGGGTGAGG - Intronic
1134676354 16:16093375-16093397 GGGAAAGAAAGGCGGGGGTGCGG - Intronic
1135732923 16:24909347-24909369 GTAAACATAAGGCTGGGGTGCGG + Intronic
1136270029 16:29142957-29142979 GTAAGAAAAAGGGAGGGGTGGGG - Intergenic
1137293177 16:47066026-47066048 GTAAAAGCCAGCCAGGGGAGGGG + Intergenic
1138145115 16:54602255-54602277 GGAAAAGGCAGGTAGGGGTGGGG - Intergenic
1139563937 16:67761115-67761137 GTGAAACCAAGGAACGGGTGTGG - Intronic
1139579490 16:67863968-67863990 GTAAAAGCAATGCTGGGATGAGG + Intronic
1140250639 16:73291312-73291334 TCAAAGGGAAGGCAGGGGTGAGG + Intergenic
1140315586 16:73893592-73893614 AAAAAAATAAGGCAGGGGTGGGG - Intergenic
1140321672 16:73958449-73958471 GCAAAAGCAAGGCAAAGGGGAGG - Intergenic
1140342730 16:74181069-74181091 GAAAAAGAAAGGAAGGGGAGGGG + Intergenic
1140527496 16:75635603-75635625 GGAAAAGGAAGGCAAGGGAGAGG + Intronic
1141878491 16:86842382-86842404 CTTGAAGGAAGGCAGGGGTGAGG + Intergenic
1142073621 16:88104795-88104817 GTAGGAGAAAGGGAGGGGTGGGG - Intronic
1142177937 16:88653411-88653433 GGAAAAGCAGGGCAGGGGCACGG + Intronic
1143184657 17:5002979-5003001 GGAAAAACAGGGTAGGGGTGGGG - Intronic
1143836745 17:9699086-9699108 GGAAACGCAAGGCATGGGTGGGG + Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1145956955 17:28861288-28861310 GCTCAAACAAGGCAGGGGTGGGG - Intergenic
1146782798 17:35690460-35690482 GTAAAAGCCAGACATGGCTGAGG - Intronic
1147161184 17:38570277-38570299 GTGTAAGCGAGGCAGGGGTCTGG - Intronic
1147196458 17:38769994-38770016 GTAGAAGAAAGGCAGTGGGGAGG + Intronic
1147330600 17:39696820-39696842 ACAACAGCAGGGCAGGGGTGGGG + Intronic
1148542562 17:48492329-48492351 GGAAAAGCAGCGCGGGGGTGGGG - Intergenic
1148867715 17:50637554-50637576 GAAAATGCAAGGAGGGGGTGGGG + Intronic
1149361158 17:55897359-55897381 GTAAGAGCCAGGCAGGGGAAGGG - Intergenic
1151392481 17:73797045-73797067 GAAAAAGAAAGGCAGGTGGGAGG + Intergenic
1151542203 17:74770329-74770351 GTAGAAGCAAGGGTGGGGTGGGG - Intergenic
1151852829 17:76701132-76701154 GGAAGAGCCTGGCAGGGGTGGGG + Intronic
1151944509 17:77312156-77312178 GCCACAGCAGGGCAGGGGTGGGG - Intronic
1152193612 17:78903241-78903263 GTGACATCATGGCAGGGGTGAGG + Intronic
1152516616 17:80828547-80828569 GTAAAGCCAAGGCAGGGGTCGGG - Intronic
1152596908 17:81242228-81242250 GAAGGAGGAAGGCAGGGGTGGGG - Intergenic
1153932575 18:9891503-9891525 GAAAAAGCAACGCAAAGGTGTGG + Intergenic
1155231288 18:23777783-23777805 GTAAAAGACAGGCTGGAGTGGGG - Intronic
1155941049 18:31802404-31802426 GAAAAAGGAAGGTAGAGGTGAGG - Intergenic
1156483670 18:37451569-37451591 GGAAGTGCAAGGCAGGGATGTGG - Intronic
1156843760 18:41639183-41639205 ATAAAAGAAAGGGAGGGGAGGGG + Intergenic
1157263062 18:46193285-46193307 CTAAAAAAAAAGCAGGGGTGGGG - Intronic
1157531293 18:48423110-48423132 GGAAAAGAAAGGCAGGCGGGAGG - Intergenic
1157553503 18:48597565-48597587 GCAGGAGCAAGGCAGGGGTGGGG - Intronic
1158410225 18:57198876-57198898 ATAGAAGCAAGGGAGGGGAGAGG - Intergenic
1159890119 18:73945059-73945081 GGAACATCAAGGCAGGGGAGAGG - Intergenic
1160122858 18:76146140-76146162 TTAAAAGCAGGACAGGTGTGGGG + Intergenic
1161146644 19:2682820-2682842 GTAACTGCAATGCTGGGGTGAGG + Intronic
1161330949 19:3687654-3687676 GACACAGCAAGGAAGGGGTGAGG + Intronic
1161649936 19:5478188-5478210 GGAAAAGCTAGGCAGGGGGCTGG + Intergenic
1162187216 19:8915028-8915050 GTAAGAGCCAGGCAGAAGTGAGG + Intronic
1163216703 19:15884332-15884354 GTAGAAGGGAGGGAGGGGTGAGG + Intronic
1163298594 19:16429139-16429161 GAGAATGCAAGGGAGGGGTGGGG - Intronic
1164135489 19:22411325-22411347 GCAAAAGCAAGGGCTGGGTGCGG - Intronic
1166037613 19:40180524-40180546 CTGAAAGCAAGGCAGTGGGGTGG + Intergenic
1166192323 19:41183258-41183280 GGAAAAGAAAGGATGGGGTGAGG + Intergenic
1166302837 19:41921976-41921998 GTAGAATGAAGGCAAGGGTGGGG - Intronic
1166927563 19:46279363-46279385 GGAAAGGCAAGGCAGGGAAGGGG - Intergenic
1167666191 19:50823835-50823857 GTGCCAGCAGGGCAGGGGTGGGG - Intergenic
1167789377 19:51663604-51663626 GAAAAAGAAAGGAAGAGGTGAGG - Intergenic
1168245426 19:55110890-55110912 GGAATGGAAAGGCAGGGGTGGGG + Intronic
925212343 2:2060713-2060735 GGAAAAGGAAGGGAGGGGGGAGG - Intronic
925855438 2:8124876-8124898 AGAAAAGCAGGGCGGGGGTGGGG - Intergenic
926724313 2:15985156-15985178 GGAAAAGCAAGGAGAGGGTGAGG - Intergenic
927201396 2:20580160-20580182 GAATAAGCAAGGCAAGGCTGAGG + Intronic
927215555 2:20666479-20666501 GTAAAAGCAAGGTTTGGGCGCGG - Intergenic
927243309 2:20937178-20937200 GTTGAAGCGAGGCAGGGTTGAGG + Intergenic
928490503 2:31778261-31778283 GGCAAAGCGATGCAGGGGTGTGG - Intergenic
929305135 2:40352988-40353010 TTAAAAATAAGGCTGGGGTGTGG - Intronic
930445427 2:51465306-51465328 GTTAACACATGGCAGGGGTGGGG - Intergenic
932757235 2:74417308-74417330 GTAGAAGCAAAGTAGGGTTGGGG + Intronic
932800669 2:74739823-74739845 GCAACAGCAAGGCAGGGGCCTGG + Intergenic
933804428 2:85987832-85987854 GCAGATGCAAGACAGGGGTGGGG - Intergenic
933994414 2:87657259-87657281 GTGGAATCAAGGCAGGGGCGAGG - Intergenic
934652834 2:96102065-96102087 GGAAAGGCAGGCCAGGGGTGAGG + Intergenic
934711866 2:96521393-96521415 GTGACAACAAGGAAGGGGTGAGG + Intergenic
934937905 2:98478488-98478510 GTCAAGGCGAGGCAGGGCTGTGG + Intronic
935040368 2:99420469-99420491 AGAAAGGCAAGGCAGGGCTGAGG - Intronic
935315019 2:101824103-101824125 GTAAGGGCATGGCGGGGGTGGGG + Intronic
935315246 2:101826933-101826955 ATACAAGCAAAGTAGGGGTGTGG - Intronic
936299444 2:111293654-111293676 GTGGAATCAAGGCAGGGGCGAGG + Intergenic
936944104 2:117915098-117915120 TTTAAAAGAAGGCAGGGGTGGGG + Intergenic
937764120 2:125640086-125640108 ATAAAATCAAGGAAGGGGAGAGG + Intergenic
939020747 2:136955683-136955705 GTAAAAGCAGGGCAATCGTGAGG + Intronic
939063166 2:137449142-137449164 GAAAAAGAAAGGCAGGCTTGTGG + Intronic
940319585 2:152362574-152362596 AAAAAAGCAAGCAAGGGGTGGGG - Intronic
940591482 2:155733796-155733818 GTAAAAGCCAAGCAGAGGTCTGG - Intergenic
941944428 2:171078989-171079011 GTGAAAGGTAGGCAGGGGTCAGG - Intronic
941992959 2:171574828-171574850 GCATATGCAGGGCAGGGGTGGGG + Intergenic
942035244 2:172004187-172004209 GTAATAGCCAGGCAGGGGAGGGG + Intronic
942199038 2:173552446-173552468 GCAAAAGAAAGACAGGTGTGGGG + Intergenic
942219592 2:173756238-173756260 GGAAAAGCAAGGCAGGGCAGGGG + Intergenic
942656590 2:178220244-178220266 CTTAAAAAAAGGCAGGGGTGGGG - Intronic
943639356 2:190342582-190342604 GTGAAAGCCAGGGAAGGGTGGGG + Intronic
944002393 2:194855139-194855161 GTGGCAGCAAGGCTGGGGTGGGG + Intergenic
944852376 2:203733118-203733140 ATCACAGCAGGGCAGGGGTGAGG - Intronic
947261069 2:228223244-228223266 GAGAAAGCAAGGCAGGTGAGGGG - Intergenic
947767371 2:232646297-232646319 GTGAGAGCAAGGCCTGGGTGGGG - Intronic
947841005 2:233208087-233208109 GTGGAAGGAAGGAAGGGGTGCGG - Intergenic
947914675 2:233823497-233823519 GCAAACGTCAGGCAGGGGTGGGG + Intronic
947996757 2:234534492-234534514 GGAAGAGCAAGGCTGGTGTGGGG + Intergenic
948224539 2:236298897-236298919 CTGAAATCAAGGCATGGGTGGGG - Intergenic
948373559 2:237505600-237505622 GTGAAATCTAGACAGGGGTGTGG - Intronic
948386491 2:237584026-237584048 GTACAGGCAGGGCAGGTGTGAGG + Intronic
948741116 2:240046566-240046588 GTGACACCATGGCAGGGGTGAGG + Intergenic
1168860543 20:1043337-1043359 GTAAGACCAATGCAGGAGTGAGG + Intergenic
1168913731 20:1469583-1469605 GCCAAAGGAAGGCTGGGGTGGGG - Intronic
1169376979 20:5074011-5074033 GAACAAGCAAGGCGGGGGAGGGG + Intronic
1169997093 20:11570791-11570813 CTAAAATCAAGGCACTGGTGAGG + Intergenic
1170299190 20:14863379-14863401 GGTAAAGGAGGGCAGGGGTGAGG + Intronic
1170472280 20:16680260-16680282 ATAAAAGCAAACCAAGGGTGTGG + Intergenic
1171355981 20:24545643-24545665 ATAAAAGCTAGGAATGGGTGGGG + Intronic
1171781434 20:29422185-29422207 GTTGAAGCAAGGCAGAGGTCTGG + Intergenic
1171794740 20:29558027-29558049 GAAAAAGCAAGCCAGAGCTGTGG + Intergenic
1171857082 20:30356655-30356677 GAAAAAGCAAGGAAGAGGAGAGG + Intergenic
1172844614 20:37922526-37922548 GGAAAACCAAGGCAGAGCTGAGG - Intronic
1173670583 20:44796090-44796112 GTGAAGGCACGGCAGGGGAGGGG - Intronic
1175145901 20:56895969-56895991 ATAAAAATAAGGCAGGGGAGGGG - Intergenic
1175707145 20:61188172-61188194 CTAAAAGCCAGGCAAGGGCGTGG - Intergenic
1175919535 20:62444190-62444212 GTCAACTCAAGGCAGGGCTGGGG + Intergenic
1176118697 20:63444570-63444592 GCAAACCCCAGGCAGGGGTGGGG + Intronic
1177844439 21:26272141-26272163 GTGAAAGCAAGCCAGGGTAGAGG - Intergenic
1178037705 21:28603178-28603200 GAAGAAGCAGGGCAGGGATGGGG - Intergenic
1179168465 21:38953976-38953998 GACAAAGAAAGGCAGGGGTTGGG - Intergenic
1179556665 21:42182946-42182968 CTTAAAGCAGGGCAGGGGTCAGG - Intergenic
1180004804 21:45015418-45015440 GGAAAAGCAGGGGAGGGGAGGGG + Intergenic
1180953027 22:19729292-19729314 GTCCAAGCAGGGCAGGGGAGGGG + Intergenic
1181617078 22:24062227-24062249 GTAACAGCAAAGCAGGGAGGTGG - Intronic
1182423010 22:30257627-30257649 GGAGAAGCAGGGCCGGGGTGTGG + Intergenic
1183650286 22:39149695-39149717 CTAAAAGCTAGGCAGGGGAGGGG + Intronic
1184044154 22:41961997-41962019 GTAAAAGCAACACAGTGGAGGGG + Intergenic
1184045758 22:41971432-41971454 GAAGAGGCCAGGCAGGGGTGAGG - Intergenic
1184399724 22:44266956-44266978 GTAAAAGGCAGGCAGTGGGGTGG + Intronic
949433368 3:4002501-4002523 GAAAAAGCAAGGCTGGGGGAAGG + Intronic
949807666 3:7973647-7973669 GGAAAACCAAAGCAGGGGAGAGG + Intergenic
950045935 3:9948735-9948757 GTGAGAGCATGGCTGGGGTGTGG - Intronic
950321388 3:12057731-12057753 GTAAAAGCATGTCACGGGAGTGG - Intronic
950683123 3:14598855-14598877 GGAAAAGCAAGGCAGGCGGAGGG - Intergenic
950726808 3:14922143-14922165 GTGGGAGCATGGCAGGGGTGTGG - Intronic
951208472 3:19947853-19947875 GTCAAAGCAAGGCAGGTTCGGGG + Intronic
951412464 3:22381547-22381569 TAAAAAGCAATGTAGGGGTGTGG - Intergenic
953814536 3:46143773-46143795 GGAAATGCAGGGCAGGGGAGAGG - Intergenic
954457419 3:50607444-50607466 GCAAGAGCAAGGCATGGGAGAGG - Exonic
954613613 3:51958718-51958740 GCCCAAGAAAGGCAGGGGTGGGG - Intronic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
955111736 3:55957523-55957545 GCAAAACCCAAGCAGGGGTGCGG - Intronic
956686520 3:71833886-71833908 ATAAAAATAGGGCAGGGGTGGGG - Intergenic
957079039 3:75621759-75621781 GTACAAGGCAGGCAGGGGAGAGG + Intergenic
958675230 3:97261156-97261178 TTAAAAACAAAGCAGGGCTGGGG + Intronic
959710549 3:109381602-109381624 GTAGAATCAAGGGAGGGGTTCGG - Intergenic
959756071 3:109900800-109900822 GTAAAAACAAGGCAGAGGCCAGG - Intergenic
959811171 3:110621239-110621261 GAAAAAGCAAGAAAGGGGTTGGG - Intergenic
962051162 3:131817176-131817198 GAGAAAGCAAAGCAGGGTTGGGG + Intronic
962492648 3:135909157-135909179 GGAAAAGTAAGGCATGGGTTAGG - Intergenic
963194839 3:142515602-142515624 GTAAAGGCAAGGCAGTACTGAGG - Intronic
964608533 3:158585299-158585321 GTGGAAGCAAGAGAGGGGTGGGG - Intronic
965173118 3:165293976-165293998 GGAAAGGGAAGGCAGGGGAGGGG + Intergenic
965620799 3:170640811-170640833 GTGGAGGGAAGGCAGGGGTGTGG - Intronic
966164980 3:177007025-177007047 GCAGGAGCAAGGCAGGGGTTGGG - Intergenic
967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG + Intronic
967787542 3:193513837-193513859 GGAAAAGAAGGGAAGGGGTGGGG - Intronic
968122944 3:196139053-196139075 GGAAAAACAAAGCAGGAGTGAGG - Intergenic
968298369 3:197594412-197594434 GTAAAAGCAAGCCTGGGGCCAGG - Intergenic
969074766 4:4569229-4569251 CTTAGTGCAAGGCAGGGGTGGGG - Intergenic
969088893 4:4677654-4677676 GTGCAAGCAGGGCTGGGGTGTGG + Intergenic
969147842 4:5139614-5139636 GTAGAAGCCAGGCAGAAGTGGGG + Intronic
969454084 4:7291270-7291292 TTAAAAGCAGGACAGGGGTGTGG + Intronic
969703331 4:8779539-8779561 GGACAAGGAAGGCAGGGCTGGGG - Intergenic
969896918 4:10313904-10313926 GCAAAAGAAAGGCAAGGGGGAGG - Intergenic
970960205 4:21862516-21862538 GTAAAAGCACAGCAGAGGGGTGG + Intronic
972609801 4:40645990-40646012 GTAAAAGCAAGGGAGAGGACAGG + Intergenic
972718802 4:41675451-41675473 GAAAAAGCAAGGCACGGGTGGGG - Intronic
973157612 4:46976508-46976530 GCAAAAGCATGGTAGGGGTGTGG - Intronic
975271664 4:72442475-72442497 GAAAAAGCAAGGCAGGAGGAAGG + Intronic
975591677 4:76006783-76006805 TGAAAAGCAAGGCAGTGGGGAGG - Intronic
976999589 4:91481074-91481096 GGGAAGGGAAGGCAGGGGTGGGG - Intronic
977392607 4:96430907-96430929 GTAATAACAAGGTAGGGGAGGGG - Intergenic
977784699 4:101019302-101019324 GTGAAAGCAAAGGAGGGGTGGGG - Intergenic
979904111 4:126262853-126262875 GTAAAATAAAGACAGGAGTGGGG + Intergenic
980671259 4:136009454-136009476 GAAAAAGCAAGCAAGGGGTCTGG - Intergenic
980820068 4:138003536-138003558 GTAAAAACAAGACAGGGTAGGGG + Intergenic
981266371 4:142788609-142788631 GGGAAGGCCAGGCAGGGGTGGGG - Intronic
981589194 4:146338967-146338989 GAAAAAGCAAGGCAGAGACGTGG + Intronic
982264711 4:153527636-153527658 ATTAAATCAGGGCAGGGGTGGGG - Intronic
983641771 4:169950043-169950065 GAAAAAGCTAGGGAGAGGTGTGG - Intergenic
983725484 4:170918387-170918409 ATAAAAGGCAGGCAGTGGTGTGG + Intergenic
983830798 4:172325414-172325436 GTAAAATCTAGGCAGAGTTGTGG + Intronic
983845831 4:172516171-172516193 GTAAATGCTAGTCAGTGGTGAGG + Intronic
983997639 4:174205027-174205049 GTCAACTCAAGGCAGTGGTGTGG - Intergenic
985012359 4:185596827-185596849 GTAAAAGCAAGGACGGGGGCCGG - Intronic
985447431 4:190032528-190032550 GTTGAAGCAAGGCAGAGGTCTGG + Intergenic
985888668 5:2699479-2699501 GGAAGACCAAGGCAGGGGTGGGG + Intergenic
987595602 5:19994116-19994138 GAAAAAGCAAGGAATGGGTATGG + Intronic
988588162 5:32525800-32525822 GTGAAAGCCATGCAGGCGTGAGG - Intergenic
988632266 5:32943908-32943930 GAAAAAACAGGGTAGGGGTGAGG + Intergenic
988774332 5:34463721-34463743 GGAAAAGCAGGCCAGGCGTGTGG + Intergenic
989070890 5:37510231-37510253 GGAAAAGGAAGGAAGGGGTAAGG - Intronic
989108582 5:37886205-37886227 GGAAAACCAAGGTGGGGGTGGGG + Intergenic
989237659 5:39167672-39167694 GTAACTGCAGGGCAGTGGTGGGG + Intronic
990041938 5:51387248-51387270 GTAAAAGAAAGGGAGGAGGGAGG + Intronic
992013828 5:72556783-72556805 AGACAAGCAGGGCAGGGGTGAGG + Intergenic
992375077 5:76181053-76181075 GTAACACCAAGGCTGGGGTAAGG - Intronic
992611885 5:78515148-78515170 TTAAAAACAGGGCAGGGGTAGGG - Intronic
993840913 5:92877212-92877234 GAGGCAGCAAGGCAGGGGTGAGG - Intergenic
994011200 5:94905107-94905129 GAAGAAGCAAGGCAGGTGAGTGG + Intronic
994072998 5:95621543-95621565 GCAGGAGCAAGGCAGGGGTCTGG - Exonic
994396913 5:99232937-99232959 GTAAAACCCAGGGAGGGGAGTGG - Intergenic
994994279 5:107039605-107039627 GTAGAAGGAAGGCAGGTGGGGGG + Intergenic
995198153 5:109396767-109396789 AAAAAAAAAAGGCAGGGGTGGGG + Intronic
997189178 5:131914513-131914535 GAAAAAGGAAGGGAGGGGAGGGG + Intronic
997514528 5:134477567-134477589 GTCAAAGTGAGGCAGGGGTCAGG + Intergenic
997605687 5:135174259-135174281 TTAAGAGCAAGGGAGGGGTTGGG + Intronic
997836743 5:137200403-137200425 GAAAAAGTAAGGCAGGGAAGTGG - Intronic
999038143 5:148376427-148376449 GAAAAAAAAAGGCGGGGGTGGGG + Intergenic
1001106718 5:168860803-168860825 GGAAAGGCAAGGCAGGGCAGGGG - Intronic
1001163672 5:169344055-169344077 AAAAAAGAAAGGCAGGAGTGAGG + Intergenic
1001268600 5:170293523-170293545 GTGAAAGCGAGGCTGAGGTGGGG - Intronic
1002400797 5:178990750-178990772 GTAGGAGCAGGGCTGGGGTGAGG + Intronic
1005305129 6:24506008-24506030 GAAAAAGCAAAGCAGAGGAGGGG - Intronic
1006505194 6:34484848-34484870 GGAAAAATAAAGCAGGGGTGAGG + Intronic
1006510302 6:34517746-34517768 AGGAAAGCAAGGCAGGGGAGGGG - Intronic
1007153442 6:39718446-39718468 GAAAAAGCAAAGCAGGGGCCAGG + Intronic
1007790102 6:44303895-44303917 GTAGAAACAAGGAAGGGGAGCGG + Intronic
1007935859 6:45731255-45731277 GTAAAAGCAAGGCATTGTTATGG + Intergenic
1008408371 6:51144285-51144307 GAAAAGGAAAGGCAGGGATGTGG + Intergenic
1010099850 6:72091152-72091174 GTAAAAGCAGGGCAGAGGCCAGG - Intronic
1010433898 6:75808857-75808879 GTAAACTCAAGGCAGGGGGAGGG + Intronic
1010701534 6:79054190-79054212 GAAATAGAAAGGCAGGGGAGGGG + Intronic
1010999725 6:82574238-82574260 TATAAAGAAAGGCAGGGGTGAGG + Intergenic
1012039810 6:94189636-94189658 GAAAAGACAAGGCAGGGGAGGGG + Intergenic
1012192819 6:96301281-96301303 GTCAAAGCACGTGAGGGGTGAGG - Intergenic
1016617079 6:146062911-146062933 GTAAAGGCATGGCAAGGGTGAGG - Intronic
1016823829 6:148370096-148370118 GTAAGTGGAAGGCAGAGGTGAGG + Intronic
1017025951 6:150180719-150180741 CTAAGAGCATGGCTGGGGTGGGG + Intronic
1017282637 6:152640194-152640216 GAAAAAGCAAGGGAGGGGCCAGG + Intergenic
1017587335 6:155941470-155941492 GAAAAAGCAAAGCAGTGGTCTGG - Intergenic
1017666131 6:156721671-156721693 GTGCAGGGAAGGCAGGGGTGGGG - Intergenic
1017780742 6:157713519-157713541 GGAAAAGCGAAGCAAGGGTGAGG + Intronic
1017824341 6:158070518-158070540 TTAAAGGCAAGGGCGGGGTGAGG + Intronic
1018677863 6:166238015-166238037 GTAAAAGATAGACAGAGGTGAGG - Intergenic
1019666057 7:2252804-2252826 GGAATAGGAGGGCAGGGGTGAGG - Exonic
1019774982 7:2906939-2906961 GGAGAAGCAAGGCAGGGAAGGGG - Intronic
1020434921 7:8152166-8152188 GTGAAAGCCAGGCAGGGGGTGGG + Intronic
1021550686 7:21868061-21868083 TGAAAAGAAGGGCAGGGGTGGGG - Intronic
1022813114 7:33888306-33888328 GGAAAGGCAGGGGAGGGGTGAGG - Intergenic
1023165749 7:37342295-37342317 GTCATGGCAAGGCAGGGATGGGG + Intronic
1023765161 7:43504014-43504036 ATAAAAGCAAGGAAGCGTTGGGG - Intronic
1025068486 7:55878437-55878459 TTAAAAGCAAGGCATGGGCCGGG + Intergenic
1028751851 7:94391818-94391840 GGAAAAACAAGTAAGGGGTGGGG - Intergenic
1029451035 7:100641874-100641896 GTAAAAGCAGGAGAGGGGAGGGG - Intronic
1031693224 7:124816820-124816842 AGAAAAATAAGGCAGGGGTGGGG + Intergenic
1032576605 7:133061130-133061152 CTAAGAGGAAGGCCGGGGTGGGG + Intronic
1033314062 7:140283316-140283338 GTCCAAGCCAGGCAGGGGTCGGG + Intergenic
1033355304 7:140594355-140594377 GGAACTGCAAGGCAGGAGTGTGG - Intronic
1033529521 7:142248146-142248168 GGAAATGCATGGCAGGGGTCTGG - Intergenic
1034155400 7:148952259-148952281 GAACAATCTAGGCAGGGGTGAGG + Intergenic
1034464433 7:151218180-151218202 GTAGATGCAAGGCTGAGGTGGGG + Exonic
1035163438 7:156968198-156968220 CGAAAGGCAAGGCAGGGGAGCGG - Intronic
1035778134 8:2205647-2205669 GTAACAGCAAGGCAAAGCTGCGG + Intergenic
1037482822 8:19320722-19320744 TAAACAGCAAGGCGGGGGTGTGG - Intronic
1038110297 8:24489380-24489402 GTAGAACCTAGGCAGGGATGTGG + Intronic
1038454962 8:27667102-27667124 CCAATAACAAGGCAGGGGTGAGG - Intronic
1039282491 8:36001206-36001228 GTAACAGGCAGGCAGGGTTGAGG - Intergenic
1039399007 8:37252779-37252801 GTAAGAGCAAGGCAGTGGACTGG - Intergenic
1039459389 8:37730730-37730752 GTAAATGGAAGGTGGGGGTGAGG + Intergenic
1039620817 8:38996132-38996154 GTTAAGGGAAGGCAGGGTTGGGG - Intronic
1040011006 8:42661237-42661259 GTAGAAGCAAGAAAGAGGTGTGG + Intergenic
1040333619 8:46404949-46404971 GCAAAAACAAGGCAGCAGTGTGG + Intergenic
1040746046 8:50643753-50643775 GTAACAGCAGGGCTGGGGAGGGG + Intronic
1040915919 8:52565823-52565845 AAAAAAGCAGGGCCGGGGTGCGG + Intergenic
1041354544 8:56986476-56986498 GTACAACCAAGTCAGGGGTCAGG + Intronic
1042472653 8:69208959-69208981 CTAAAGGCAAGGCAGGAGGGAGG - Intergenic
1042893724 8:73642708-73642730 AAAAAAGCAAGGCAGGGGCCTGG + Intronic
1048580322 8:135725160-135725182 GAAAAAACAAGGCTGGGATGAGG + Intergenic
1049505775 8:142996752-142996774 TTAAAAGCAAGGCATGCTTGTGG + Intergenic
1049528508 8:143141896-143141918 GTGAAGGGAAGGCAGGCGTGAGG + Intergenic
1049591783 8:143466045-143466067 GACAGAGCACGGCAGGGGTGTGG - Intronic
1050629794 9:7546290-7546312 GTCAAAGCAAGGCAGCAGTGAGG + Intergenic
1050671038 9:7997202-7997224 GTCAAATGAAGGCAGGGGTGAGG + Intergenic
1051135869 9:13919635-13919657 GTGAAAGCCAGGCAGATGTGGGG - Intergenic
1051347169 9:16162637-16162659 GCAAAAGCAAGGCATTGGTGGGG + Intergenic
1053485917 9:38456198-38456220 GTAAAGGCAGGGGAAGGGTGAGG + Intergenic
1054153640 9:61625236-61625258 GAAAAAGCAAGCCAGAGCTGTGG + Intergenic
1054453991 9:65420281-65420303 GGAAAAGGAAGGAAGGGGAGGGG + Intergenic
1055716582 9:79124816-79124838 GACAAAAAAAGGCAGGGGTGGGG - Intergenic
1057507050 9:95643244-95643266 GTAACAAAAAGGCAGGGGTGGGG + Intergenic
1058046200 9:100359794-100359816 GGAAAAGCAAGGGCTGGGTGTGG + Intergenic
1058884743 9:109314640-109314662 TTAAAAGAAAGGCTGAGGTGGGG - Intronic
1058932250 9:109732726-109732748 GAAAAAGAAAGTCAGGGGAGGGG + Intronic
1059011655 9:110467946-110467968 GTAGGAGCAAGGCAGGGGGTTGG - Intronic
1059821520 9:117978609-117978631 ATGAAAGCAAGGATGGGGTGGGG + Intergenic
1060948827 9:127587688-127587710 ATAAAAGCAAAGAAGGGCTGTGG - Intergenic
1061010909 9:127954135-127954157 ACAAACACAAGGCAGGGGTGAGG + Intronic
1061239949 9:129364135-129364157 GTAAAGACAAGGCAGGGTGGGGG - Intergenic
1061433005 9:130543148-130543170 TTCTAAGCAAGGGAGGGGTGTGG + Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061631363 9:131874261-131874283 GTACAGGCAAGGCTGGGATGGGG - Intronic
1061678571 9:132231607-132231629 GGAAAAGCAAGAGAGGGTTGGGG - Intronic
1061733404 9:132634963-132634985 GTCAATCAAAGGCAGGGGTGTGG - Intronic
1061765427 9:132878449-132878471 GGAAAAGCGAGGCCGGGGTTGGG - Exonic
1061884957 9:133586747-133586769 GTAGGAGTAAGGCAGGGGTGGGG + Intergenic
1062535216 9:137018412-137018434 GGGAAAGCAAGGCACGGGGGCGG + Intronic
1186598549 X:11010663-11010685 GTGTGAGCAATGCAGGGGTGGGG - Intergenic
1186813468 X:13212625-13212647 GTCCAAGCAGGGCAGGGGGGTGG + Intergenic
1187140200 X:16585940-16585962 TTGTCAGCAAGGCAGGGGTGTGG + Intergenic
1187566989 X:20460610-20460632 GTGAAAGAAAGGCATGAGTGAGG - Intergenic
1188873387 X:35400778-35400800 GTAAAAAGAAGGCAAGGGAGAGG - Intergenic
1189819974 X:44860914-44860936 GTAAATGGAAGGAAGAGGTGGGG - Intergenic
1192007655 X:67234516-67234538 GTGACAGCAAGGCTGGGGAGGGG + Intergenic
1192562453 X:72136181-72136203 GTCAAGGCAAGGCAGGGTGGTGG - Intronic
1193165682 X:78277484-78277506 GCAAAAGCACTTCAGGGGTGTGG - Intronic
1196818618 X:119685374-119685396 GTCAAAGCAGGGAAGGGGTGGGG + Intronic
1197793378 X:130277610-130277632 GTAAAAGGGAGTTAGGGGTGGGG - Intergenic
1198187334 X:134266358-134266380 GTAAAAGGAATGCAAGTGTGAGG - Intergenic
1198994068 X:142553315-142553337 GAAAAAGCTAGCCAGGTGTGGGG + Intergenic
1199614539 X:149646516-149646538 GGAAAAGTAAGAGAGGGGTGAGG - Intergenic
1199649587 X:149939186-149939208 GGAGAAGCAGGGCAGGGCTGGGG + Intergenic
1199893817 X:152113851-152113873 GAAAAAGTAAGAAAGGGGTGAGG - Intergenic
1199952795 X:152718770-152718792 GGAAATGTAAGACAGGGGTGAGG + Intergenic
1199956888 X:152749678-152749700 GGAAATGTAAGACAGGGGTGAGG - Intergenic
1200323923 X:155217504-155217526 GTAAAAAAAAGGCAGAGGTAAGG - Intronic
1200816045 Y:7533487-7533509 GTAAAAGCAAGCCCGGGATAGGG - Intergenic
1201148594 Y:11081791-11081813 GTGAATGTAAGGGAGGGGTGTGG + Intergenic
1201393107 Y:13520024-13520046 CTAACTGCAAGGCAGAGGTGAGG - Intergenic
1202380798 Y:24275655-24275677 GAAAAAGCAGGGCAGTGGGGTGG - Intergenic
1202489986 Y:25394470-25394492 GAAAAAGCAGGGCAGTGGGGTGG + Intergenic