ID: 967182409

View in Genome Browser
Species Human (GRCh38)
Location 3:186917890-186917912
Sequence GGACCATATCCCAGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967182409_967182420 23 Left 967182409 3:186917890-186917912 CCTGCAGGGCTGGGATATGGTCC No data
Right 967182420 3:186917936-186917958 AGCATACACTTAGTGCACAAGGG No data
967182409_967182419 22 Left 967182409 3:186917890-186917912 CCTGCAGGGCTGGGATATGGTCC No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967182409 Original CRISPR GGACCATATCCCAGCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr