ID: 967182412

View in Genome Browser
Species Human (GRCh38)
Location 3:186917913-186917935
Sequence TTATGGGGGTGGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967182412_967182420 0 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182420 3:186917936-186917958 AGCATACACTTAGTGCACAAGGG No data
967182412_967182421 13 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182412_967182422 28 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182422 3:186917964-186917986 CAGTAAGGCCCTCAAACTGACGG No data
967182412_967182419 -1 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967182412 Original CRISPR TTATGGGGGTGGAAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr