ID: 967182413

View in Genome Browser
Species Human (GRCh38)
Location 3:186917920-186917942
Sequence GTATGCTTTATGGGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967182413_967182426 29 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182426 3:186917972-186917994 CCCTCAAACTGACGGCTGGGAGG No data
967182413_967182420 -7 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182420 3:186917936-186917958 AGCATACACTTAGTGCACAAGGG No data
967182413_967182421 6 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182413_967182423 25 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182423 3:186917968-186917990 AAGGCCCTCAAACTGACGGCTGG No data
967182413_967182419 -8 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data
967182413_967182422 21 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182422 3:186917964-186917986 CAGTAAGGCCCTCAAACTGACGG No data
967182413_967182424 26 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182424 3:186917969-186917991 AGGCCCTCAAACTGACGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967182413 Original CRISPR GTATGCTTTATGGGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr