ID: 967182419

View in Genome Browser
Species Human (GRCh38)
Location 3:186917935-186917957
Sequence AAGCATACACTTAGTGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967182409_967182419 22 Left 967182409 3:186917890-186917912 CCTGCAGGGCTGGGATATGGTCC No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data
967182410_967182419 1 Left 967182410 3:186917911-186917933 CCCCTTCTGCCTTCCACCCCCAT No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data
967182411_967182419 0 Left 967182411 3:186917912-186917934 CCCTTCTGCCTTCCACCCCCATA No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data
967182413_967182419 -8 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data
967182412_967182419 -1 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182419 3:186917935-186917957 AAGCATACACTTAGTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967182419 Original CRISPR AAGCATACACTTAGTGCACA AGG Intergenic
No off target data available for this crispr