ID: 967182421

View in Genome Browser
Species Human (GRCh38)
Location 3:186917949-186917971
Sequence TGCACAAGGGCTACTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967182411_967182421 14 Left 967182411 3:186917912-186917934 CCCTTCTGCCTTCCACCCCCATA No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182414_967182421 2 Left 967182414 3:186917924-186917946 CCACCCCCATAAAGCATACACTT No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182416_967182421 -2 Left 967182416 3:186917928-186917950 CCCCATAAAGCATACACTTAGTG No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182417_967182421 -3 Left 967182417 3:186917929-186917951 CCCATAAAGCATACACTTAGTGC No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182413_967182421 6 Left 967182413 3:186917920-186917942 CCTTCCACCCCCATAAAGCATAC No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182418_967182421 -4 Left 967182418 3:186917930-186917952 CCATAAAGCATACACTTAGTGCA No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182415_967182421 -1 Left 967182415 3:186917927-186917949 CCCCCATAAAGCATACACTTAGT No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182412_967182421 13 Left 967182412 3:186917913-186917935 CCTTCTGCCTTCCACCCCCATAA No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data
967182410_967182421 15 Left 967182410 3:186917911-186917933 CCCCTTCTGCCTTCCACCCCCAT No data
Right 967182421 3:186917949-186917971 TGCACAAGGGCTACTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967182421 Original CRISPR TGCACAAGGGCTACTCAGTA AGG Intergenic
No off target data available for this crispr