ID: 967183056

View in Genome Browser
Species Human (GRCh38)
Location 3:186923042-186923064
Sequence CACAAAGAAATTCCTCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967183056_967183059 12 Left 967183056 3:186923042-186923064 CCCTTTGGAGGAATTTCTTTGTG No data
Right 967183059 3:186923077-186923099 GAGCCTTAGAGGTAACCCAGTGG No data
967183056_967183058 1 Left 967183056 3:186923042-186923064 CCCTTTGGAGGAATTTCTTTGTG No data
Right 967183058 3:186923066-186923088 GAAGCTAGAAAGAGCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967183056 Original CRISPR CACAAAGAAATTCCTCCAAA GGG (reversed) Intergenic
No off target data available for this crispr