ID: 967183965

View in Genome Browser
Species Human (GRCh38)
Location 3:186930151-186930173
Sequence CTCAGGGTCTCGCAGTCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967183959_967183965 27 Left 967183959 3:186930101-186930123 CCTATTCTAGATAAGAGCAACAC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG 0: 1
1: 0
2: 4
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967183965 Original CRISPR CTCAGGGTCTCGCAGTCAGC CGG Intergenic
902538650 1:17136690-17136712 CTCAGGATCTGGTAGGCAGCAGG + Intergenic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
903285866 1:22276247-22276269 CTCAAGGTCACACCGTCAGCTGG - Intergenic
903913242 1:26744225-26744247 CACAGGCTCAGGCAGTCAGCAGG - Intronic
904290808 1:29484884-29484906 CCCAGGGTCTCGCAGCTGGCAGG + Intergenic
904447718 1:30588429-30588451 CTCAGGGGCTCACAGTCTGATGG - Intergenic
905363697 1:37437311-37437333 ACCAGGGTCTCGGAGTCACCAGG - Intergenic
906724888 1:48037014-48037036 CTCAGAGACTGGCAGTCAGAGGG - Intergenic
906759548 1:48363404-48363426 CTCAGGGTCTCATAAACAGCAGG - Intronic
909898976 1:81109331-81109353 CTCCGAGTCCAGCAGTCAGCTGG + Intergenic
911380433 1:97107096-97107118 GTCAGGGTGAGGCAGTCAGCAGG - Intronic
912234503 1:107835084-107835106 CTCCTGGCCTAGCAGTCAGCAGG - Intronic
913259331 1:116984456-116984478 CTCAAGGTCATGTAGTCAGCAGG - Intronic
915748857 1:158185806-158185828 CTCAGAGTTTCTCATTCAGCGGG - Intergenic
919811356 1:201410728-201410750 CTCCTGGTCTGGCACTCAGCAGG + Intronic
920366643 1:205451353-205451375 CTCAGGTACTCCCATTCAGCCGG + Intronic
921319244 1:213921987-213922009 ATCAGGGTCTAGCATACAGCAGG + Intergenic
923542372 1:234897730-234897752 CCCAGGGTCTCTGATTCAGCAGG + Intergenic
923651022 1:235873941-235873963 CTCATGGTCTCTCATTCAGAAGG + Intronic
1064028293 10:11866821-11866843 CTCTGGGTCTCACAGACACCAGG - Intronic
1064144813 10:12819215-12819237 CTCATGGTGTGGCACTCAGCAGG - Intronic
1065341448 10:24710603-24710625 CTCAGTGTCTGGCACTCAGAAGG + Intronic
1066162347 10:32747072-32747094 CCAAGGGTCTCCCAGTCTGCTGG - Intronic
1067668975 10:48302587-48302609 CTCAAGGTTTCTCACTCAGCCGG + Intergenic
1068366020 10:56051174-56051196 CTCAAGGTCTTGCAATCAGTAGG + Intergenic
1075049553 10:119172789-119172811 CACAGAGTCTCGCTGTCACCAGG + Intronic
1075504189 10:123008320-123008342 CCCAGGGGCTGGGAGTCAGCCGG - Intronic
1075703486 10:124484266-124484288 TTCAGGATCTGGCAGGCAGCTGG - Exonic
1076643257 10:131933423-131933445 CTCAAGGGCTCGCAGTGACCTGG - Intronic
1077990155 11:7400385-7400407 TTCAGAGTCTGTCAGTCAGCTGG + Intronic
1079835953 11:25333076-25333098 CTCAAGATCAAGCAGTCAGCAGG - Intergenic
1081627006 11:44662103-44662125 CTCAGGGACTGGCAGATAGCAGG - Intergenic
1082693941 11:56337065-56337087 CTCCGAGCCTAGCAGTCAGCTGG - Intergenic
1082959466 11:58905310-58905332 CTCTGCGACTTGCAGTCAGCTGG + Intergenic
1084960340 11:72713104-72713126 CTCAGGGTCTGACAGGCAGCTGG + Intronic
1085392888 11:76191480-76191502 CTCAGGGTCACGCACACAGCAGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1091700003 12:2652932-2652954 ATCAGGCCCTCGCAGTCACCCGG - Intronic
1093274548 12:17108043-17108065 CTCAGGCTCTCACAGTCTACAGG - Intergenic
1096103975 12:48986111-48986133 CACAGGGTCTGGCATTCAGCTGG - Intergenic
1097107048 12:56632140-56632162 CTCAGGGACTTGAGGTCAGCAGG - Intronic
1101695294 12:107119860-107119882 CTCAAGATCTCACAGTAAGCGGG + Intergenic
1102138395 12:110594323-110594345 CTCAGGATTTCGAGGTCAGCAGG - Intergenic
1102434158 12:112907613-112907635 CTCAAGGTCTTGCAGCCAGCAGG - Intronic
1103916967 12:124380703-124380725 CTCAGAGTCTCGCAGGGAACAGG + Intronic
1104638376 12:130451731-130451753 CTCTCGGTCTCGCTGTGAGCAGG - Intronic
1106100976 13:26695047-26695069 CTCAGGGGCGTGCAGACAGCAGG - Intergenic
1107746516 13:43516072-43516094 CTAAGTATCTAGCAGTCAGCGGG + Intronic
1112185386 13:97123569-97123591 CTCAGGGCCTCCCGGTCAACTGG - Intergenic
1114242912 14:20885470-20885492 CTCAGGGTTTCCCAGACATCAGG + Intergenic
1114249839 14:20949407-20949429 CTCAGGGTTTCCCAGACATCAGG + Intergenic
1114769481 14:25412065-25412087 CTGAGGATCTCACAGGCAGCAGG + Intergenic
1120760895 14:88284279-88284301 CCCAGGGTCTCCCAGTCCCCAGG - Intronic
1120951274 14:90044323-90044345 CCCAGGGTCACACAGTGAGCGGG + Exonic
1121007786 14:90501244-90501266 CACAGGGATGCGCAGTCAGCAGG - Intergenic
1122178166 14:99936522-99936544 CATAGGGGCTCACAGTCAGCAGG - Intronic
1122406082 14:101501923-101501945 CACAGGGCCTGGCACTCAGCTGG + Intergenic
1125244550 15:37620007-37620029 TTCAGAGTCTCTCAGTAAGCTGG + Intergenic
1125774495 15:42199414-42199436 CTCACGGTCACGCAGCCAGGGGG + Intronic
1128310657 15:66630084-66630106 CCCAAGGTCACACAGTCAGCAGG - Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1132391434 15:101441479-101441501 CACAGGGTCCTGCACTCAGCAGG + Intronic
1132857778 16:2054653-2054675 CCCAGAGACTCACAGTCAGCAGG - Intronic
1133757660 16:8774798-8774820 CCCAGGGTTTGGCAGTTAGCTGG + Intronic
1133777507 16:8909059-8909081 CACAGAGTCCGGCAGTCAGCTGG - Intronic
1134192269 16:12130895-12130917 CTCGGTGCCTCGCTGTCAGCAGG - Intronic
1136073729 16:27804509-27804531 CTCAGGGACTCACAGTCTGAGGG - Intronic
1138862022 16:60770189-60770211 CTCAAGGCCCTGCAGTCAGCTGG + Intergenic
1138862028 16:60770236-60770258 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862034 16:60770283-60770305 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862039 16:60770330-60770352 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862044 16:60770377-60770399 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862049 16:60770424-60770446 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862052 16:60770471-60770493 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862055 16:60770518-60770540 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862059 16:60770565-60770587 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862062 16:60770612-60770634 CTCAAGATCCAGCAGTCAGCTGG + Intergenic
1138862065 16:60770659-60770681 CTCAAAGTCCTGCAGTCAGCTGG + Intergenic
1139786243 16:69394580-69394602 CATAGGGTCTTGCACTCAGCAGG + Intronic
1141429885 16:83966020-83966042 CTCAGGGCCTGGGAGCCAGCGGG - Exonic
1141719129 16:85745722-85745744 AGCAGGGTCCCTCAGTCAGCGGG - Intronic
1142021429 16:87785319-87785341 CTGAGGGTGTCGCAGCCAGAAGG - Intergenic
1142194983 16:88735257-88735279 CGCAGGGTGTCACAGTCAGCCGG + Intronic
1142376185 16:89708210-89708232 CTCAGCCTCTCCCAGACAGCAGG - Intronic
1143015929 17:3891185-3891207 CACAGAGTCTGGCAGACAGCAGG - Intronic
1143754055 17:9053621-9053643 CTCAGGGTCTAGCAGGATGCTGG + Intronic
1144737464 17:17563164-17563186 CTCAGGGGCTCTTAGTCTGCCGG - Intronic
1146166077 17:30590022-30590044 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1146222358 17:31035554-31035576 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1146344824 17:32052501-32052523 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1146354959 17:32126129-32126151 CTCAGGGCCTGGCACCCAGCAGG + Intergenic
1146814343 17:35930564-35930586 CTCCGGAACTCCCAGTCAGCGGG + Intronic
1147167470 17:38601182-38601204 CTCAAGGTCACGCAGACATCTGG + Intronic
1148088411 17:45008165-45008187 CTCAGGGCCTCACAGGCAGTAGG - Intergenic
1148169998 17:45511061-45511083 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1148279210 17:46334755-46334777 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1148301427 17:46552608-46552630 CTTAGGGTCTTGCATGCAGCTGG - Intronic
1148739083 17:49881715-49881737 CTCAGAGGCTCCCAGTCAGTGGG - Intergenic
1148739534 17:49884674-49884696 CACAGTGCCTGGCAGTCAGCGGG + Intergenic
1150401080 17:64856657-64856679 CTTAGGGTCTTGCATGCAGCTGG + Intronic
1150632729 17:66891402-66891424 CTCAGGATCTCCCAGGCAGTTGG + Intergenic
1150781198 17:68123685-68123707 CTTAGGGTCTTGCATGCAGCTGG + Intergenic
1158536761 18:58315282-58315304 CTCAGGCTCTGGGAGTCATCTGG - Intronic
1159321084 18:66849747-66849769 CTCAAGGTCTAGCAGGCAGTGGG + Intergenic
1160265845 18:77340317-77340339 CACAGGATGTCTCAGTCAGCTGG - Intergenic
1162503402 19:11067622-11067644 CTCAGGGTCTCTGATGCAGCTGG - Intergenic
1164277494 19:23733884-23733906 GACGGGGTCTCGCAGTCACCAGG + Intergenic
1165040882 19:33066607-33066629 CACAGAGTCTAGCAGCCAGCAGG - Intergenic
1165819443 19:38665271-38665293 CCCAGGGTCGCACAGCCAGCCGG - Intronic
1166111725 19:40626971-40626993 CACAGGGCCTCGAAGTCATCTGG - Exonic
1167379939 19:49132958-49132980 CCCAGGGGCTCGCAGTCCACGGG + Intronic
1168340057 19:55617567-55617589 CTCAGGGCCTGGCAGGCAGGAGG - Exonic
932575625 2:72960956-72960978 GTGAGGGTCACGCAGTCAACAGG - Intronic
934661564 2:96146051-96146073 CTCAGGGTCTTGCAGTAGGTTGG + Intergenic
934928951 2:98404655-98404677 CCCAGGGGCTCTTAGTCAGCAGG - Intergenic
936648960 2:114404480-114404502 CTCAGGGTTTCTCTTTCAGCAGG - Intergenic
938408148 2:131044161-131044183 CTCAGGATCTCACTGTCTGCTGG + Intronic
939128881 2:138210642-138210664 CTCAGCCACTCGCAGTCACCAGG - Intergenic
942328944 2:174801731-174801753 CGGAGGGTTTCGCAGTGAGCAGG + Exonic
944149993 2:196547750-196547772 CTCACCATCTCCCAGTCAGCAGG + Intronic
947205944 2:227661230-227661252 CCCACTGCCTCGCAGTCAGCAGG - Intergenic
947829024 2:233125788-233125810 CACAGGAGCTGGCAGTCAGCGGG - Exonic
948772539 2:240258949-240258971 CTCAGGGACACACAGTCAGCCGG - Intergenic
948904280 2:240970893-240970915 CTCTGGGTCTCACAGTCATGGGG + Intronic
1168732986 20:103534-103556 CTCCAGGTCCAGCAGTCAGCTGG - Intergenic
1169149702 20:3279762-3279784 CCCAGTGTCTCACAGGCAGCTGG + Intronic
1170695029 20:18650316-18650338 CACAGGGCCTCGCACTCAACTGG - Intronic
1170759126 20:19234267-19234289 CTCAGAGGCTCCCATTCAGCAGG - Intronic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1172173542 20:32959105-32959127 CACAAGGTCTGGCAGTCAGTAGG - Intronic
1173677076 20:44845224-44845246 CCCAGGGTCTGGCATCCAGCAGG + Intergenic
1175540377 20:59744232-59744254 CCCAGGGTCACACAGCCAGCAGG + Intronic
1175913771 20:62416346-62416368 CCCAGGGCCTGGCAGGCAGCAGG + Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1178781048 21:35603728-35603750 CTCAGGGCCTCGCACACAGCAGG - Intronic
1180613567 22:17113217-17113239 GTCAGGGTCTCTCTGTCACCAGG + Exonic
1180782377 22:18528491-18528513 CTCAGGATCCCGCAGTCGCCAGG - Intronic
1181125930 22:20702518-20702540 CTCAGGATCCCGCAGTCGCCAGG - Intergenic
1181239266 22:21467826-21467848 CTCAGGATCCCGCAGTCGCCAGG - Intergenic
1182435571 22:30327275-30327297 CTTGGGGTCTCGCAGGGAGCGGG - Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1183732438 22:39626166-39626188 CTCAGGGTCCCACAGCCAGTGGG - Intronic
1185393541 22:50575528-50575550 CTCTGGGTCTCCCAGCCACCTGG - Intronic
949167565 3:960445-960467 CTCAAGGTCACGCAGCTAGCAGG - Intergenic
951797579 3:26557876-26557898 CTCAAGGTCTCACAACCAGCAGG + Intergenic
952698332 3:36297011-36297033 CTCAAGGTCATGCAGTCAGCAGG - Intergenic
953801285 3:46024921-46024943 CTCAGAGTCTAGAAGTCAGTTGG - Intronic
954331274 3:49891664-49891686 CTCAGGGTCACTCAGTAAGGTGG + Intronic
956717588 3:72091966-72091988 CACAGGGTCTCAGAGTTAGCAGG - Intergenic
959193810 3:103151033-103151055 CTCAGAGTCTCTCAGTAAGCTGG - Intergenic
960602841 3:119475090-119475112 CTCAGGGACTAGCAGTCTGAGGG - Intronic
961507177 3:127377896-127377918 CTCAGGGTCTGAGAGTCAGGTGG - Intergenic
961854709 3:129858141-129858163 CTCAAGGTCACACAGCCAGCAGG + Intronic
962236780 3:133713709-133713731 CTCAGGGTCCGGCAGTCAGCAGG + Intergenic
962880760 3:139574271-139574293 CCCAGGGTCACACAGCCAGCTGG - Intronic
965361905 3:167752064-167752086 CTCAGGGTCTGGCAGAAAGCAGG - Intronic
966222895 3:177568100-177568122 TCCAGGGGCTCGCATTCAGCAGG - Intergenic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
968593888 4:1472729-1472751 GTCAGGCTCTCGCTGTCACCTGG + Intergenic
968770416 4:2502261-2502283 CTCAGGGTCTGGCAGAGAGAAGG - Intronic
968876260 4:3269376-3269398 CACAGGGTCTCCAAGTCAGGAGG + Intronic
969256644 4:6007038-6007060 CGCAGGGCCTGGCTGTCAGCAGG + Intergenic
969298017 4:6280990-6281012 CCCAGAGTCTCACAGTGAGCTGG - Intronic
969310350 4:6349304-6349326 CTCAGGGTCACACAGCCAGGAGG - Intronic
969449455 4:7264776-7264798 CTCAGGGTCTGGCCTGCAGCTGG - Intronic
969676415 4:8616784-8616806 CTCATGGACTCGCATTTAGCGGG - Intronic
969844103 4:9905894-9905916 CTCTGGGTCACACAGTCAGCTGG - Intronic
971381106 4:26098763-26098785 CTCAGGCTCTTGCTGTCTGCTGG + Intergenic
975180073 4:71334205-71334227 CCCAAGGTCTCTTAGTCAGCAGG + Intronic
976207570 4:82637473-82637495 CTCAGGGTCTGGCACATAGCAGG - Intronic
982086713 4:151842939-151842961 CTCAGGGCCTCTCAGCAAGCTGG - Intergenic
982092138 4:151889516-151889538 CTCAGTGTTTGGAAGTCAGCTGG - Intergenic
986064517 5:4222802-4222824 CTCAGGGTCGGGGAGTCCGCAGG + Intergenic
986858708 5:11903294-11903316 CTCAGGGTCTGGCAAGCCGCGGG + Intronic
989111491 5:37910744-37910766 CTCAAGGTCTCACAGTTAGTAGG + Intergenic
995414884 5:111898509-111898531 CTAATGATCTCCCAGTCAGCAGG + Intronic
997292692 5:132748650-132748672 CTCAGGGTCATGTAGTCATCAGG + Intronic
997553305 5:134772494-134772516 GACAGAGTCTCGCAGTCACCAGG - Intronic
997740451 5:136248390-136248412 CACAGGGTCTGGCACACAGCAGG + Intronic
998483390 5:142481298-142481320 CTCAGGGTCTTGCTGCCAGTAGG - Intergenic
999729653 5:154467268-154467290 CCCAGGGTCTCACAGTGAACTGG + Intergenic
1001445009 5:171776239-171776261 CCCACGGTCTCACAGTGAGCGGG + Intergenic
1001529246 5:172450981-172451003 CTCAGGATCTCACAGGCACCTGG + Intronic
1001809186 5:174614152-174614174 CTCAGGGTCTGGGTGGCAGCAGG - Intergenic
1001963307 5:175893708-175893730 TCCAGGCTCTGGCAGTCAGCTGG + Intergenic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1003305409 6:4922610-4922632 CTCAGGATCTGGCAACCAGCAGG - Intronic
1003538498 6:6997477-6997499 CTCAAGGTCACACAGTTAGCAGG + Intergenic
1004182206 6:13390699-13390721 CACAGGGTCTCACTGTCACCAGG - Intronic
1006974410 6:38085050-38085072 CTCTGTGTCCTGCAGTCAGCAGG + Intronic
1012814700 6:104008480-104008502 CTGAGGGTCACACAGTCAGTAGG - Intergenic
1015391026 6:132681992-132682014 CTCAGAGTCTATCAGTCAGTTGG + Exonic
1017723637 6:157261836-157261858 TCCAGTGTCTCGCAGTCAGAGGG - Intergenic
1018397256 6:163387981-163388003 TTCATGGTCTTGCAGGCAGCTGG - Intergenic
1019961794 7:4466674-4466696 CTCAGGGTTTCTGATTCAGCAGG - Intergenic
1023962405 7:44937838-44937860 CTCAGGGTCTCTCATCCACCTGG - Intergenic
1025998614 7:66544128-66544150 CTGAGGGTCTCCCAGCCAGAGGG - Intergenic
1026112632 7:67470373-67470395 CTCAGGGTCGGGGAGGCAGCGGG + Intergenic
1029348581 7:99996956-99996978 CTCAGGGTCTCACAGTGATCCGG - Intergenic
1032403158 7:131637821-131637843 AGCAGGGTATCCCAGTCAGCAGG - Intergenic
1032462247 7:132120731-132120753 TTAAGGATCTCACAGTCAGCCGG + Intergenic
1033448648 7:141443299-141443321 CTGAGGGAATCGGAGTCAGCTGG - Intronic
1034948559 7:155280733-155280755 CTCAGGGTCTCCCCCACAGCGGG + Intergenic
1037525354 8:19719044-19719066 CTCAGGTTTTAGCAGTCAGCAGG - Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1039360517 8:36872112-36872134 CTCAGGGGCTCACAGTCCCCAGG + Intronic
1047965317 8:130042137-130042159 CTCAGAGACTCTGAGTCAGCAGG - Intergenic
1048037822 8:130693807-130693829 CTCCCGGCCTGGCAGTCAGCAGG + Intergenic
1048872016 8:138806969-138806991 CTCAGGGCCTGGCCCTCAGCAGG + Intronic
1049201174 8:141341381-141341403 CCCAGGGCCTGGCACTCAGCAGG - Intergenic
1049353299 8:142175608-142175630 CCCAGGATCTCACAGCCAGCTGG + Intergenic
1053303155 9:36965942-36965964 CCCAGGGTATAGCAGACAGCCGG + Intronic
1053479748 9:38407352-38407374 CTCAGGGTCACACAGCGAGCCGG + Intergenic
1055207641 9:73751709-73751731 CTCCTGGCCTAGCAGTCAGCTGG + Intergenic
1060052741 9:120388689-120388711 CTCAGCATCTCACAGTCTGCTGG - Intergenic
1060819785 9:126654720-126654742 CTCAGAGTCTGGCATCCAGCAGG - Intronic
1060976425 9:127767846-127767868 CTCAAGGTCACACAGTCAGTGGG + Intronic
1061865615 9:133490604-133490626 CTCAGGGTGTGGCAGTGAGGAGG - Intergenic
1061870765 9:133519137-133519159 CTCAGGGTCTCGCTGGCTGAGGG - Intronic
1188941324 X:36241367-36241389 CTCTTGGCCTGGCAGTCAGCTGG - Intronic
1190094222 X:47466229-47466251 CTCAGGGTCATGCAGTCATTAGG - Intronic
1193484773 X:82073479-82073501 GTCAGGGTCTCACAGTCTACTGG - Intergenic
1196820171 X:119694819-119694841 TGCAGGGCCTCGCAGTCAGGAGG + Intergenic
1199106330 X:143873366-143873388 CTGAGGCTGTTGCAGTCAGCTGG - Intergenic
1201057604 Y:10011410-10011432 CTCAGTGTCACGATGTCAGCTGG - Intergenic
1202189275 Y:22224125-22224147 CTCAGTGTCACGATGTCAGCTGG + Intergenic