ID: 967184115

View in Genome Browser
Species Human (GRCh38)
Location 3:186930755-186930777
Sequence CGACCGGCGTGGGCGCGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967184108_967184115 3 Left 967184108 3:186930729-186930751 CCGGCGTTAACAAAGGGAGCCGA 0: 1
1: 0
2: 0
3: 0
4: 21
Right 967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
967184107_967184115 4 Left 967184107 3:186930728-186930750 CCCGGCGTTAACAAAGGGAGCCG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 89
967184104_967184115 16 Left 967184104 3:186930716-186930738 CCTGGGGCACTGCCCGGCGTTAA 0: 1
1: 0
2: 0
3: 6
4: 40
Right 967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967184115 Original CRISPR CGACCGGCGTGGGCGCGGAG CGG Exonic
900206972 1:1435788-1435810 CGGCTGGCGCTGGCGCGGAGCGG + Exonic
900314544 1:2050420-2050442 CGTCCGGCGGGGGCGGGGGGCGG - Intergenic
901607678 1:10472248-10472270 CGTCCGGCGGGGGCGAGGCGGGG - Intronic
903347954 1:22699806-22699828 TGACGGGGGTGGGGGCGGAGGGG - Intergenic
904050210 1:27634293-27634315 AGACCGCCGCGGGCGCGGAGGGG + Intronic
905862767 1:41361903-41361925 CGCCCGGCTCGGGCGAGGAGGGG - Exonic
906087374 1:43147758-43147780 CGACCGGCGGGCGCGGGGCGGGG + Intronic
915570187 1:156741102-156741124 CGACGGGCGTGGCGGGGGAGGGG - Intronic
918122191 1:181549819-181549841 CCACTGGAGTGGGCGTGGAGTGG + Intronic
922287660 1:224183686-224183708 CGGCCGGCGTGGGCCTGGCGGGG - Intronic
922505356 1:226122582-226122604 CGGCCGGCGCGGGGGCAGAGGGG + Intergenic
922821409 1:228487925-228487947 GGACCGGGGCGGGGGCGGAGAGG - Intronic
924436809 1:244049263-244049285 CGGCCCGCGGGGGCGCGGCGCGG - Intronic
1070954273 10:80454251-80454273 CGAGCGGCGGGGGCGGGGCGCGG - Exonic
1076146553 10:128126532-128126554 CGCAGGGCGTGGGCGGGGAGGGG + Intergenic
1077204650 11:1336679-1336701 CGCCCGGCGAGGGCGGGGCGGGG + Intergenic
1077285605 11:1763979-1764001 CGGCCGGCGTGCGCGGGGCGGGG + Exonic
1078093682 11:8283645-8283667 CGACCGGCGTGGGCTGGGGCTGG - Intergenic
1082816967 11:57515420-57515442 TGAGCAGCGTGGGCGGGGAGGGG - Intronic
1083303740 11:61752510-61752532 CGGCCGGGCTGGGCGCGGCGCGG + Intergenic
1084588763 11:70078471-70078493 CGGCGGGCCTGGGCGCGGGGAGG + Exonic
1085465559 11:76721158-76721180 GGACCGGAGTGGGGGCGGGGTGG - Intergenic
1096154497 12:49334454-49334476 CGACCGCCATGAGCCCGGAGGGG - Intronic
1096782817 12:54000752-54000774 CAACCGGCGCGGGAGGGGAGGGG + Intronic
1118285264 14:64465379-64465401 CGACCGCCGGAGGCGCGGGGCGG - Intronic
1121074920 14:91060220-91060242 CCGCAGCCGTGGGCGCGGAGGGG - Intronic
1123033991 14:105464331-105464353 CGGCCGGCGTGGGGGTGGCGGGG + Intronic
1126668442 15:51094780-51094802 CGGCCGGCGGGCGCGGGGAGCGG - Intronic
1128743692 15:70099374-70099396 CGGCCGGAGCGGGCGCGGGGAGG - Intergenic
1132355840 15:101170672-101170694 GGACAGGCAGGGGCGCGGAGTGG - Intergenic
1133188433 16:4116295-4116317 CCCCCGGCGTGGGCGCGGGCGGG - Intergenic
1138327902 16:56191152-56191174 GGACTGGCGGGGGCGGGGAGTGG - Intergenic
1138594951 16:58024983-58025005 CGGCCGGAGTCGGCGCGGGGCGG - Intergenic
1139506247 16:67399499-67399521 CGACCGGCCGGGCCGCAGAGCGG - Intronic
1142136346 16:88453560-88453582 CGGGCGGCGGGGGCGCGGCGGGG - Exonic
1142206501 16:88785390-88785412 CGACTGGCGCTGGCCCGGAGCGG + Intergenic
1147341391 17:39754861-39754883 CGAGCGGCGTGGGCGGCGGGAGG + Intergenic
1148437422 17:47694689-47694711 CCAGCGGGGTGGGCGCAGAGGGG + Intronic
1150624745 17:66834890-66834912 GGGCCGGCGTGGGAGAGGAGAGG - Intergenic
1151218371 17:72592863-72592885 GGAGCGGGGTGGGCGGGGAGGGG + Intergenic
1151586641 17:75012751-75012773 CGCCCGGCGTGGGCACCGTGCGG - Exonic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152834362 17:82519843-82519865 CCACCGGCGCCCGCGCGGAGCGG + Exonic
1156350737 18:36298652-36298674 GGAGGGGCGGGGGCGCGGAGGGG + Intronic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1160390478 18:78527639-78527661 CGACAGTGGTGGGCGTGGAGGGG - Intergenic
1160725597 19:616636-616658 GGACGGCCGGGGGCGCGGAGGGG - Exonic
1161963214 19:7534197-7534219 CTAGCGGTGTTGGCGCGGAGTGG + Exonic
1163597077 19:18226385-18226407 GGACCGGGGCGGGCGCGGGGGGG + Intronic
1163828923 19:19538560-19538582 CGACCACCTGGGGCGCGGAGCGG + Intronic
1168404971 19:56105951-56105973 TGACTGCCGTGGGCGCGGAGGGG - Intronic
1168404981 19:56105985-56106007 TGACTGCCGTGGGCGCGGAGGGG - Intronic
1168404992 19:56106026-56106048 TGACTGCCGTGGGCGCGGAGGGG - Intronic
1168405010 19:56106094-56106116 TGACTGCCGTGGGCGCGGAAGGG - Intronic
926250768 2:11154696-11154718 CTAGCGGCGTGGGCCCTGAGGGG - Intergenic
927542808 2:23927438-23927460 CGGCCGGCGAAGGCGCGGGGTGG + Intronic
940646037 2:156393976-156393998 CCACCGGCGGGGGCGGGAAGGGG + Intergenic
1169195973 20:3682155-3682177 CGAGCGGGGTTGGCGGGGAGGGG - Exonic
1172702910 20:36863632-36863654 CGATCGGCGTGCGGGCGGCGGGG - Exonic
1178525458 21:33324868-33324890 GGAACGGCGCGTGCGCGGAGGGG + Intronic
1179128311 21:38611797-38611819 GGACAGGGGTGGGCACGGAGTGG + Intronic
1180014690 21:45074534-45074556 GGGCCGGCGGGGGCGGGGAGGGG + Intronic
1185037917 22:48489423-48489445 CGGGCGGCGCGGGCGCGGCGCGG + Intergenic
1185397621 22:50600889-50600911 CGCCCGGCCCGGGCGCCGAGGGG - Intronic
950710575 3:14810632-14810654 CGCCGGGCGGGGGCGCGGGGCGG - Intergenic
962676836 3:137764115-137764137 CGACTGGTGGGGGCGGGGAGAGG - Intergenic
967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG + Exonic
970408702 4:15787188-15787210 CGGCCAGAGTGGGCGCGCAGAGG + Intronic
981504090 4:145481668-145481690 CGGCCGGCGTGAGCGCAGCGCGG - Intronic
984772165 4:183445147-183445169 GGACCGGCCTCGGCGGGGAGGGG + Intronic
985896260 5:2751482-2751504 CGCCCGGCCGGGGCGCGGCGCGG + Exonic
992249916 5:74866416-74866438 CGGTGGGCGCGGGCGCGGAGCGG - Intronic
1001605762 5:172958814-172958836 CGGCCGGAGTGGGCGGGGACTGG + Intronic
1002487737 5:179550930-179550952 CCGCCGGCGCGGGCGCGGTGGGG + Intronic
1003868302 6:10382563-10382585 GGACCGGCGTGGGCGTGGGCTGG + Intergenic
1004140548 6:13013783-13013805 CGGCCGGCGCGGGCGGGGCGGGG + Intronic
1007783205 6:44265637-44265659 CGCCCGCCGGGGGCGGGGAGGGG - Exonic
1014045347 6:116877683-116877705 CTACTGGGGTGGGGGCGGAGGGG - Intronic
1014230098 6:118893968-118893990 CCGCCGGCGGCGGCGCGGAGAGG - Intronic
1018091197 6:160348163-160348185 CGGCCGGGGTGGGCGCGCGGTGG - Intergenic
1019179077 6:170175927-170175949 CAGCCGGCTTGGGAGCGGAGAGG + Intergenic
1019731503 7:2631915-2631937 GGACGGGCGGGGGTGCGGAGGGG + Intergenic
1028773593 7:94655755-94655777 GGGCCCGCGGGGGCGCGGAGAGG + Intronic
1030033572 7:105389233-105389255 CGACCGGCCGGGGTGCGGAGGGG - Intronic
1031317278 7:120273383-120273405 CGGGCGGCGTTGGCGCGGTGGGG - Intergenic
1049628191 8:143636126-143636148 CACCCGGCGCGGGCGGGGAGAGG - Intronic
1049762232 8:144336769-144336791 CAACCGGCGCGGGCGGAGAGGGG + Intergenic
1056852267 9:90094592-90094614 GGACCGGGGTGGGCGGGGGGCGG + Intergenic
1059234533 9:112750784-112750806 CGGCGGGCTCGGGCGCGGAGCGG + Intergenic
1061584041 9:131554963-131554985 CGGGCGGCGTGGGCGCGGCTGGG - Intergenic
1202800341 9_KI270719v1_random:169982-170004 CCGCCGGCGCAGGCGCGGAGGGG + Intergenic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic