ID: 967185946

View in Genome Browser
Species Human (GRCh38)
Location 3:186944768-186944790
Sequence CTCTCCAATTACCCTTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967185946_967185949 17 Left 967185946 3:186944768-186944790 CCTTCAAAAGGGTAATTGGAGAG 0: 1
1: 0
2: 0
3: 7
4: 162
Right 967185949 3:186944808-186944830 CGCTTTTGCTCATATTCCATTGG 0: 1
1: 1
2: 12
3: 84
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967185946 Original CRISPR CTCTCCAATTACCCTTTTGA AGG (reversed) Intronic
901182680 1:7352366-7352388 CTTCCCAATTACCCTTTCTAGGG - Intronic
902058819 1:13624408-13624430 CTCTGCCATCACTCTTTTGAGGG + Intergenic
906054194 1:42901841-42901863 CCATCCAATCACCCTTTTCAAGG - Intergenic
909076655 1:71056806-71056828 CTCTCAAATTACCCTCTAAAAGG + Intergenic
909204658 1:72739926-72739948 CTCCTAAATTACCCATTTGAGGG + Intergenic
913372300 1:118114376-118114398 TTCTACAATTACCTTGTTGAGGG + Intronic
916198769 1:162250113-162250135 CTCTCCCATTTCCCCTTTCAGGG + Intronic
917659013 1:177159446-177159468 CTCTCCATCTTCCCATTTGAGGG - Intronic
922308799 1:224368608-224368630 CTCTATATTTAACCTTTTGAGGG + Intronic
1063193956 10:3722748-3722770 CTCTGCTATGACCCTTGTGATGG - Intergenic
1063314024 10:4984225-4984247 CTCTCGAAGTCCCATTTTGAGGG - Intronic
1064092107 10:12394317-12394339 CTCTCCAATTAGGGTTTTTATGG + Intronic
1064674410 10:17746929-17746951 CACTTCAATTATCCTTTTAACGG - Intergenic
1069750342 10:70741309-70741331 CTCACCATATACCCTTTTGTAGG + Intronic
1071982988 10:91022561-91022583 GTCTCCAATTACTTCTTTGAGGG + Intergenic
1074837190 10:117307837-117307859 CTTTCCACTTACCTGTTTGAAGG + Intronic
1075325102 10:121525245-121525267 CCTTCCAATCACTCTTTTGAAGG - Intronic
1075562962 10:123481726-123481748 CACTCAAATTCCCCTTTTGATGG + Intergenic
1075672234 10:124270538-124270560 TTCTCTAATTACATTTTTGATGG - Intergenic
1076033675 10:127180763-127180785 CTCTATAATTATCCTTTTAATGG - Intronic
1078052982 11:7983724-7983746 CTGTCCGATGCCCCTTTTGAGGG - Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079064647 11:17278801-17278823 CTTTCTAAGGACCCTTTTGAAGG + Intronic
1079123947 11:17705446-17705468 TGCTCCAATTACCCTGTTGTAGG - Intergenic
1080959105 11:37137061-37137083 CTGACAAATTACCTTTTTGATGG - Intergenic
1085654828 11:78304395-78304417 ATCTCCTATTAACCTTTTAATGG + Intronic
1085738997 11:79063429-79063451 CCCTCCCCTTACCCTTTTGCTGG + Intronic
1087727479 11:101738593-101738615 TTCTCTAATTACCCATTTGGTGG - Intronic
1089811778 11:121138041-121138063 CTCCACGATTCCCCTTTTGAGGG - Intronic
1090794972 11:130127284-130127306 CTCTCTTATAACCCTTTTAAAGG - Intronic
1095060083 12:37676251-37676273 CACTCCAAATACCCATTTGCAGG + Intergenic
1097415164 12:59306047-59306069 CTCTCTAATCACCCTTGTAATGG + Intergenic
1097899988 12:64862976-64862998 AGCTCCACATACCCTTTTGAGGG - Intronic
1101128356 12:101662846-101662868 CTTTCCATTTGCCCTTCTGAAGG + Intronic
1102424883 12:112835804-112835826 CTCTCAAATTCCCCTGTTGTTGG - Intronic
1107337641 13:39372690-39372712 CTCTCCAATTCTCCTTTCTAAGG + Intronic
1111854365 13:93618577-93618599 GTCTCTAATTACACTTTGGATGG + Intronic
1111859495 13:93683983-93684005 CTCTCTCATGACCCTTTTAAGGG + Intronic
1113845985 13:113391917-113391939 CTCACCATTTCCCCCTTTGATGG - Intergenic
1113933212 13:113979421-113979443 CTCTCCCATCCCCCTTTTCAGGG - Exonic
1114148140 14:20002653-20002675 CTGTCCATCTACCCTTTTGTGGG + Intergenic
1115233450 14:31186091-31186113 CTCTTTAATTACCTTTTTAATGG + Intronic
1115731313 14:36272457-36272479 CTGTGCAATGAGCCTTTTGAAGG + Intergenic
1116635481 14:47389564-47389586 CTTGTCAATTACCCTTTTGCAGG + Intronic
1116755687 14:48945205-48945227 TTCTCCTATTTCCCTTTTGGAGG - Intergenic
1117270955 14:54143090-54143112 CTCTCCCATGAACCTTCTGAAGG + Intergenic
1121628484 14:95404971-95404993 CTCTCCAATTAACCATGTCATGG + Intergenic
1202845811 14_GL000009v2_random:173833-173855 CTCTCCAAAGACCCATTTAATGG - Intergenic
1202915209 14_GL000194v1_random:164101-164123 CTCTCCAAAGACCCATTTAATGG - Intergenic
1202877464 14_KI270722v1_random:18616-18638 CTCTCCAAAGACCCATTTAATGG + Intergenic
1124621211 15:31275143-31275165 CTCTGGAATTCCCCTTTGGAAGG + Intergenic
1125781084 15:42268776-42268798 CTCTTCAACTAGCCTTTTGAAGG - Intronic
1130774447 15:86964205-86964227 CTCTTCAATCACTCTTTTGCAGG + Intronic
1140405086 16:74704260-74704282 CTCTGCAAAGACCCTTTTAAGGG + Intergenic
1143574034 17:7779348-7779370 CTCACCCATTTCCATTTTGATGG + Exonic
1146530839 17:33606599-33606621 TTCTCCAACTACACTGTTGAGGG + Intronic
1147775696 17:42899390-42899412 GTCTCCAGTTACCATTTTGCTGG + Intergenic
1148207718 17:45790023-45790045 CTCACCACTTCTCCTTTTGATGG - Intronic
1150349356 17:64430801-64430823 CTCTCAATTTTCCCCTTTGATGG + Intergenic
1155332518 18:24732342-24732364 CTCTCTAATTAACCTCTTGAGGG + Intergenic
1162426815 19:10602280-10602302 CTCTCAAGTAACCCTCTTGAGGG - Intergenic
1162498516 19:11037205-11037227 TTCTCTATTTAACCTTTTGAGGG + Intronic
1164357517 19:27457589-27457611 CGCTCCAATTATCCCTTTGCAGG - Intergenic
1167531716 19:50021873-50021895 CTTCCCAATCACCCTTTTCAAGG + Intronic
1202673215 1_KI270710v1_random:14325-14347 CTCTCCAAAGACCCATTTAATGG - Intergenic
927121694 2:19970384-19970406 CTCTACAATTACCTTTTTAATGG + Intronic
929154264 2:38775206-38775228 CTGGCCAGTTACCCTTTTTAAGG - Intronic
931670990 2:64647055-64647077 CTCTCCAATGTCCTTTATGAAGG - Intronic
932965772 2:76473126-76473148 CTCTCAAATTTCCCCTTTTAGGG - Intergenic
933614427 2:84469695-84469717 CTCTCAAATTTCTCTTTTTAGGG + Intergenic
939242804 2:139583374-139583396 TTCTCAAATTACCATTTTTATGG - Intergenic
939370019 2:141286805-141286827 CTCTCCTATTTTCCTTTTAATGG + Intronic
940737833 2:157473076-157473098 CACTCAGATTACCCTTTAGAAGG - Intronic
942429625 2:175897117-175897139 CTCTCCAATGACATTTTTCATGG + Intergenic
943339305 2:186659064-186659086 CACTCCAATTACTATTTTTATGG + Exonic
943388873 2:187236400-187236422 TTATCCATTTGCCCTTTTGAGGG + Intergenic
944882380 2:204026633-204026655 CTCTACAACTCCCCTTTTCAGGG - Intergenic
944883267 2:204037245-204037267 TCCTCCACTTTCCCTTTTGAGGG - Intergenic
945034752 2:205695454-205695476 CTCTCCAATTACTCTTGAAAGGG - Intronic
947077403 2:226360651-226360673 TTCTATAATTACCTTTTTGAAGG + Intergenic
947823497 2:233088852-233088874 CTCTCCAAGGCCCCTTTGGATGG - Intronic
1170219122 20:13923178-13923200 CTCTCTAATTACTGTTTTGGTGG + Intronic
1173269916 20:41524398-41524420 CTCTCTAATCTCCATTTTGAAGG - Intronic
1176634561 21:9178747-9178769 CTCTCCAAAGACCCATTTAATGG - Intergenic
1176638751 21:9276048-9276070 CTCTCCAAAGACCCATTTAATGG + Intergenic
1176663071 21:9658561-9658583 CTATCCTATTACCCTTCTAAAGG - Intergenic
1177805097 21:25867599-25867621 CTCTCCGATGACCATTTTCATGG - Intergenic
1178133171 21:29596408-29596430 CTCTCCAATTGCAGTTTAGAAGG - Intronic
1178613592 21:34110002-34110024 CTCACCCTTTAACCTTTTGAAGG + Intronic
1178631673 21:34266423-34266445 GTCTCCAATTACTGTTATGATGG - Intergenic
1180370304 22:12028377-12028399 CTCTCCAAAGACCCATTTAATGG - Intergenic
1180372055 22:12048892-12048914 CTCTCCAAAGACCCATTTAATGG + Intergenic
1180422793 22:12883555-12883577 CTCTCCAAAGACCCATTTAATGG + Intergenic
1182040612 22:27236401-27236423 TTTTCCACTTACCCTTTTGCAGG + Intergenic
1182451009 22:30421603-30421625 CTGTCCATTTACCTTTTTGCAGG + Intronic
1184885804 22:47343829-47343851 CTCTCCAAATGCCCTTCGGAGGG - Intergenic
952350088 3:32526714-32526736 CTTTCTAATTCCACTTTTGAAGG + Exonic
955196313 3:56807632-56807654 CTCTCTAATTTCAGTTTTGATGG + Intronic
955466686 3:59244402-59244424 TTCTCTAATGCCCCTTTTGATGG + Intergenic
955544458 3:60013289-60013311 CTCTGTAATTGCCCTTTAGAAGG - Intronic
955775953 3:62433240-62433262 GTTTCAAATTACCCTTTTCAAGG + Intronic
957001563 3:74892784-74892806 CTAACCAATTACCCTAGTGAGGG - Intergenic
963226237 3:142864887-142864909 TTATCCATTTACCCTGTTGATGG + Intronic
965826489 3:172735973-172735995 CACACCAATATCCCTTTTGAAGG - Intergenic
967185946 3:186944768-186944790 CTCTCCAATTACCCTTTTGAAGG - Intronic
1202748144 3_GL000221v1_random:128971-128993 CTCTCCAAAGACCCATTTAATGG - Intergenic
970712098 4:18875915-18875937 CTCTCAAATTTCCCATTTTAGGG + Intergenic
973638166 4:52878928-52878950 CTCTCCCTTTCCCCTTTTCAGGG + Intronic
976079398 4:81338057-81338079 CTCTCCTGCTGCCCTTTTGAAGG + Intergenic
977499787 4:97824116-97824138 CTCTCAAATTTCCCCTTTTAGGG - Intronic
978319782 4:107481181-107481203 ATCTCCATTTACCCTTTTCATGG - Intergenic
978628051 4:110710078-110710100 ATCTCCATTTACCACTTTGATGG - Intergenic
978972870 4:114832055-114832077 CTGTAAAATTACACTTTTGAAGG - Intronic
980988037 4:139714866-139714888 CTCTCAAATTTCCCTTGTTAGGG + Intronic
981058503 4:140393239-140393261 CTCTTCACCTACTCTTTTGATGG + Intronic
984368362 4:178828238-178828260 CTCTTCAACTTCCCTTTTAAGGG - Intergenic
985412250 4:189697482-189697504 CTATCCTATTACCCTTCTAAAGG + Intergenic
1202753638 4_GL000008v2_random:34460-34482 CTCTCCAAAGACCCATTTAATGG + Intergenic
988891161 5:35618297-35618319 CTCTCGAGTTACCCTTGTCACGG + Intronic
990070885 5:51781613-51781635 CTCTCAAATTTCCCCTTTTAGGG + Intergenic
990911047 5:60852590-60852612 TTCTCAAATTACCCTGTGGAGGG + Intergenic
997043288 5:130282471-130282493 CATTCCAATTACACTTTTTAAGG - Intergenic
998790810 5:145764559-145764581 TGCTCCAATTACACTTTTAAAGG + Intronic
999652981 5:153785326-153785348 CTCTCCATCTACCCTTAAGAGGG - Intronic
1005328057 6:24721103-24721125 CTCTCAAACTCCCCTTTTGAGGG - Intergenic
1006067890 6:31475484-31475506 CTCTCTGATTCCCCTTTTAATGG + Intergenic
1011402537 6:86979710-86979732 CTCTTCAATTACCTTTTTTTTGG - Intronic
1014934225 6:127367216-127367238 CTCTATATTTAACCTTTTGAGGG + Intergenic
1015118162 6:129671912-129671934 TTCTCAAAATACCCTTTAGAGGG + Intronic
1021699365 7:23302488-23302510 CTCTCCAATTACCCTGTTTTTGG - Intronic
1022247290 7:28572621-28572643 CCCACCAACTACCCTTTTGGAGG + Intronic
1025501078 7:61298728-61298750 CGATCCAAATATCCTTTTGAAGG + Intergenic
1025515938 7:61644951-61644973 CGATCCAAATATCCTTTTGAAGG + Intergenic
1025518772 7:61691667-61691689 CTCTCCAAATATCCCTTTGTAGG + Intergenic
1025540276 7:62073777-62073799 CGATCCAAATATCCTTTTGAAGG + Intergenic
1028603617 7:92630337-92630359 CTCTCCAATCACACTGTTCAGGG + Intronic
1030420665 7:109302788-109302810 CCCTCTCATTCCCCTTTTGATGG - Intergenic
1030947972 7:115750281-115750303 ATATCCAATTTCACTTTTGAAGG - Intergenic
1033061406 7:138112357-138112379 CTTTCCAAGTACTCTTTTCAGGG - Intronic
1034506536 7:151496722-151496744 GTCTCCAATTTCCCTTCTGTAGG + Intronic
1034638103 7:152583333-152583355 TTCTCTAATATCCCTTTTGAAGG + Intergenic
1040509476 8:48081332-48081354 CTCGCCAACTAGGCTTTTGATGG - Intergenic
1042629096 8:70796969-70796991 GTCTCCAATTACCTTTCAGAAGG - Intergenic
1044448355 8:92304396-92304418 CCCTCCAATTTCCCATTTGCTGG - Intergenic
1046681450 8:117174980-117175002 CTCTCCCATTACCCTTTCCCTGG + Intronic
1046974630 8:120260462-120260484 CTCTGCAAATAACATTTTGAAGG + Intronic
1048434443 8:134402984-134403006 CTCTCTAGTTACTCTCTTGAGGG - Intergenic
1050506478 9:6354074-6354096 CTCTCCATGGTCCCTTTTGATGG + Intergenic
1052744748 9:32429493-32429515 CTCTGCAATTACCTGTGTGATGG - Exonic
1055886741 9:81071899-81071921 CTCTACAATTACCAAGTTGAGGG - Intergenic
1060280335 9:122211671-122211693 CTCTCCTCTTACCCTTGTGGTGG - Intronic
1203757398 Un_GL000218v1:146381-146403 CTCTCCAAAGACCCATTTAATGG - Intergenic
1203716784 Un_KI270742v1:159053-159075 CTCTCCAAAGACCCATTTAATGG - Intergenic
1203534428 Un_KI270743v1:19183-19205 CTCTCCAAAGACCCATTTAATGG + Intergenic
1203651013 Un_KI270751v1:122636-122658 CTCTCCAAAGACCCATTTAATGG - Intergenic
1203670344 Un_KI270755v1:5499-5521 CTATCCTATTACCCTTCTAAAGG - Intergenic
1186859820 X:13661300-13661322 TTCTCCATTTAACCATTTGAGGG + Intronic
1188066204 X:25662606-25662628 ATCTCCAATTTCCCTTTCAATGG + Intergenic
1188474880 X:30581149-30581171 CTCTAAAGTTACCCCTTTGATGG + Intergenic
1189003954 X:36975856-36975878 TTCTCTAATTACACTTTTGCTGG - Intergenic
1191568646 X:62576263-62576285 CTCTCCAAATATCCATTTGCAGG - Intergenic
1194069224 X:89298702-89298724 TACTCTAAGTACCCTTTTGAAGG - Intergenic
1196126968 X:112111413-112111435 CTCTCTCCTTCCCCTTTTGATGG + Intergenic
1200723372 Y:6632843-6632865 TACTCTAAGTACCCTTTTGAAGG - Intergenic
1200964618 Y:9024832-9024854 CTGTCAAATTTCCCATTTGAGGG - Intergenic
1201170981 Y:11264000-11264022 CTCTCCAAAGACCCATTTAATGG - Intergenic
1202148485 Y:21823977-21823999 CTGTCAAATTCCCCATTTGAGGG + Intergenic
1202233241 Y:22678260-22678282 TTCTCCAATTGTCTTTTTGAAGG + Intergenic
1202309915 Y:23517898-23517920 TTCTCCAATTGTCTTTTTGAAGG - Intergenic
1202560886 Y:26152695-26152717 TTCTCCAATTGTCTTTTTGAAGG + Intergenic