ID: 967188703

View in Genome Browser
Species Human (GRCh38)
Location 3:186967004-186967026
Sequence TTGGACATACAGATCTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967188693_967188703 25 Left 967188693 3:186966956-186966978 CCCTGCCAAATATCTCAGCTTGT 0: 1
1: 0
2: 1
3: 13
4: 168
Right 967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
967188694_967188703 24 Left 967188694 3:186966957-186966979 CCTGCCAAATATCTCAGCTTGTT 0: 1
1: 0
2: 3
3: 15
4: 162
Right 967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
967188696_967188703 20 Left 967188696 3:186966961-186966983 CCAAATATCTCAGCTTGTTTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967188703 Original CRISPR TTGGACATACAGATCTGACA GGG Intronic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
904806057 1:33133351-33133373 TGGGCAATACAGATCTGATAGGG + Intergenic
905266289 1:36756398-36756420 TTGGTAATACAGATCTGGGAAGG + Intergenic
906952879 1:50348892-50348914 TGGTACATACAGAGATGACAGGG + Intergenic
910345767 1:86235456-86235478 TTGGACATACCGTTCTCACTTGG + Intergenic
911990073 1:104684966-104684988 TTGGAAACAAAGATCTGTCAAGG + Intergenic
912586185 1:110768171-110768193 TTTGACATACACATCTGGGAAGG - Intergenic
918258000 1:182767604-182767626 TTGGACATAGGGAAATGACATGG + Intergenic
918628277 1:186683765-186683787 TTGGACCTAGAAATCTCACAAGG + Intergenic
921917959 1:220633885-220633907 TTGGATATAAAGATCTGAATTGG + Intronic
923076424 1:230612998-230613020 TTGGTCACACAGATCTGGGAGGG + Intergenic
923451836 1:234125397-234125419 TTGGACATTGAAATGTGACAGGG - Intronic
1064779280 10:18816650-18816672 TTGAACATGCATATCTCACAGGG - Intergenic
1065409389 10:25407114-25407136 TTGGACATAGATATCTGATTTGG - Intronic
1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG + Intergenic
1068512358 10:57983071-57983093 TTGTACATATAGATCATACAAGG - Intergenic
1069271234 10:66530585-66530607 TTTAACATAAAGTTCTGACATGG - Intronic
1073878923 10:107957387-107957409 TAAGACATATATATCTGACAGGG - Intergenic
1078634646 11:13037862-13037884 TTGCACATAAATATTTGACATGG - Intergenic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1084026204 11:66451358-66451380 CTGGACATACAGAAATGAGAAGG + Intronic
1084356224 11:68640613-68640635 TTGGACATTCAGATAAGAGAAGG - Intergenic
1086105164 11:83139485-83139507 TGGGACATAAAGACCTCACAGGG + Intergenic
1086596147 11:88573656-88573678 ATGGGGATACAGAACTGACAAGG + Intronic
1088128831 11:106462351-106462373 TTTGACCTTCAGATCTGATAAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091240793 11:134050874-134050896 TTGGTCACAGAGGTCTGACAAGG - Intergenic
1099864482 12:88261613-88261635 TTGGATATATAAATCTCACAAGG + Intergenic
1100165312 12:91911050-91911072 TTAGACAGAAAGACCTGACAAGG + Intergenic
1100885251 12:99062867-99062889 TTGAAATTACGGATCTGACAAGG + Intronic
1101097664 12:101359854-101359876 TTGGAACTACAGTTCTGAGAGGG - Intronic
1103465916 12:121141870-121141892 TGGGACATTCAGCTGTGACATGG - Intronic
1104475018 12:129063968-129063990 TTGGACATACAGATGAGAAAGGG + Intergenic
1105948383 13:25208783-25208805 ATGGACTTACAGGTCTCACAGGG + Intergenic
1110673935 13:78216253-78216275 TTGGATATCAAGATCTGTCAGGG + Intergenic
1111692117 13:91577749-91577771 TTGGAAATACAGCTCTAAAATGG + Intronic
1113935797 13:113995085-113995107 TGGGACCCACAGATCTGCCAAGG + Intronic
1118376294 14:65180169-65180191 TTGGTGATAAAGTTCTGACAAGG - Intergenic
1128393938 15:67204123-67204145 TTGAATATCCAGATCTAACATGG + Exonic
1129898632 15:79128523-79128545 GTGGACAGACAGAACTGGCATGG + Intergenic
1130901337 15:88208967-88208989 TTGGACATACAGAGTTGAGTGGG + Intronic
1132997696 16:2831754-2831776 TTGGACGTCCAGATCTGGGATGG - Intronic
1142250146 16:88987967-88987989 TTGGACTTACAGAGCCGCCAAGG - Intergenic
1142907744 17:3056797-3056819 TTCGACATACGGATTTGGCAGGG - Intergenic
1143878369 17:10010828-10010850 TTGGACTTAACGATCTGACTTGG - Intronic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1145933169 17:28700334-28700356 GTGTGCTTACAGATCTGACACGG + Exonic
1155703624 18:28780475-28780497 TCTGACATACAGATATGGCAAGG + Intergenic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
926468101 2:13216039-13216061 TTGGACTTACAGCTCCCACATGG + Intergenic
929059787 2:37912142-37912164 TAGAACATCCAGTTCTGACAAGG - Intergenic
930259748 2:49131635-49131657 TTGAATGTAAAGATCTGACATGG + Intronic
931800166 2:65750277-65750299 TTGCACATACAGACCAGACCAGG + Intergenic
932240565 2:70153275-70153297 CTCCACATACAGATCTGAGAGGG + Intronic
936568202 2:113596051-113596073 TTGTACCTACAGAGGTGACATGG - Intergenic
937660303 2:124423351-124423373 TTGGACATACAGATGAGATGTGG - Intronic
941093857 2:161212930-161212952 TTGGACATTGACATCTGGCAAGG + Intronic
942571198 2:177316233-177316255 TTGGTCCTACAGACCTGTCATGG - Intronic
943256794 2:185604096-185604118 TTGAACATACATAACTGACTGGG + Intergenic
945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG + Intergenic
946582478 2:221144570-221144592 TTTGACATACAGATCAGAACAGG + Intergenic
1171129825 20:22641666-22641688 GTGGACATACAGATCTTGTAAGG - Intergenic
1173914669 20:46698119-46698141 TTGAACAACCAGATCTCACATGG + Intergenic
1182002106 22:26927970-26927992 TTGCAGATCCAGATCTGTCATGG + Intergenic
1182100099 22:27651581-27651603 TTGGAAAGACAAATCTGCCAGGG + Intergenic
1184864966 22:47197255-47197277 TTGGTCATGCAGATCTGACCGGG + Intergenic
949178230 3:1093117-1093139 TTGTACTTACAGATCTTACCAGG - Exonic
949349909 3:3114808-3114830 TTGCAAAGACATATCTGACAAGG + Intronic
952310987 3:32190163-32190185 TAGGAGATAAAGATATGACAAGG + Intergenic
952538769 3:34344035-34344057 TTGCAAATACCTATCTGACAAGG + Intergenic
956308781 3:67856005-67856027 TAGGATATTCAGATCTTACATGG + Intergenic
960568385 3:119159626-119159648 TTGGACATATATATATGACATGG + Intronic
960742554 3:120851031-120851053 TTGGGCATACACAGCTGACTGGG - Intergenic
964700475 3:159560448-159560470 TTGGACATAAAGATGCCACAGGG - Intronic
967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG + Intronic
967293056 3:187940478-187940500 TTTGACATGCAGAGCTGTCAAGG - Intergenic
967317273 3:188161205-188161227 TTTGAAATACAGATCCAACAAGG - Intronic
971709159 4:30089158-30089180 TAGGACATACACTTTTGACATGG - Intergenic
974149531 4:57989019-57989041 TTTGAAAGACAGATCTGTCAGGG + Intergenic
974832567 4:67207483-67207505 CTGGACATACAGATTTGGAAGGG - Intergenic
976583512 4:86767890-86767912 TTGGGCATTCTGATCTGAAAGGG - Exonic
978579949 4:110221503-110221525 TTGCACATACATCTCTGACAAGG - Intergenic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
987233699 5:15921440-15921462 ATGGACAGACAGATCTGAAAAGG - Intronic
989164251 5:38419115-38419137 TTGGACATACAGACATACCAGGG - Intronic
991414772 5:66380493-66380515 TTGGCTATTCAGATCAGACAGGG - Intergenic
992140397 5:73790915-73790937 TTGGACTTACAGAGCTGGAAGGG + Intronic
992301199 5:75382098-75382120 TTTGAAAAACAGATCTAACATGG + Intronic
992711536 5:79462932-79462954 TTGTACTTACATATCTGAAAAGG - Intronic
995639193 5:114234288-114234310 TTGGAAATTCTGATCTTACATGG - Intergenic
997995505 5:138582670-138582692 CTGGACATTCAGGTCTGAGATGG + Intergenic
1004209348 6:13622652-13622674 TTGGACATACTATTCTGACAAGG + Intronic
1010606407 6:77894284-77894306 TAGTACATAAAGACCTGACAAGG + Intronic
1013150895 6:107445575-107445597 TTAGACTTACACATCTGACCTGG - Intronic
1013607743 6:111765953-111765975 TTGGACAGACAGATCATAAAAGG + Intronic
1015400672 6:132784732-132784754 TTAGACATGCAGATATGACATGG + Intronic
1017017087 6:150110187-150110209 TTGGACACACAGAGATGCCAGGG + Intergenic
1020584395 7:10048025-10048047 TTTGACATAAAAATTTGACATGG - Intergenic
1027312433 7:76962972-76962994 GTGGACATAGAGAACTGAAAAGG + Intergenic
1028930304 7:96405489-96405511 TTGGACATACAAAAGTCACATGG - Intergenic
1030337238 7:108340400-108340422 TAGGACAATCTGATCTGACATGG + Intronic
1032076532 7:128838703-128838725 CTGCACATACAGACCTGCCATGG + Exonic
1032549175 7:132768398-132768420 TGAGACCTACAGATCTGACCTGG - Intergenic
1033892689 7:146034627-146034649 GAAGACATACAGATCAGACAAGG - Intergenic
1036836209 8:12070672-12070694 ATGGACATAAAGATGGGACATGG + Intronic
1036858051 8:12317241-12317263 ATGGACATAAAGATGGGACATGG + Intergenic
1052419224 9:28220793-28220815 ATGGAGATACAGATCTGGCATGG - Intronic
1052885103 9:33638681-33638703 ATGGACAGACAGTTCTGAAAAGG + Intergenic
1053646103 9:40120437-40120459 GTGGACATACAGATCTGAGGTGG + Intergenic
1053759612 9:41343103-41343125 GTGGACATACAGGTCTGAGGTGG - Intergenic
1054327115 9:63718334-63718356 GTGGACATACAGGTCTGAGGTGG + Intergenic
1054538467 9:66255539-66255561 GTGGACATACAGATCTGAGGTGG - Intergenic
1058354586 9:104068885-104068907 ATAGGCATACAGATCTCACAGGG + Intergenic
1058580757 9:106454009-106454031 TTGGACACACAGAACACACAGGG - Intergenic
1059540326 9:115123866-115123888 TTGCACATAAAGATCTGAGGAGG + Intergenic
1059669633 9:116479833-116479855 TTGGGCATATAGAAATGACAGGG - Intronic
1060572097 9:124651448-124651470 TTGGAAATTGAGATGTGACATGG - Intronic
1185598758 X:1324886-1324908 TTGGACACAGGGCTCTGACAAGG - Intergenic
1186826182 X:13342092-13342114 TTGGAGATCCATCTCTGACAAGG - Intergenic
1192206150 X:69097764-69097786 GTGGGCATGCAGATTTGACAAGG - Intergenic
1199078400 X:143549748-143549770 TTGAGCATATAGATCTGTCAGGG - Intergenic