ID: 967194135

View in Genome Browser
Species Human (GRCh38)
Location 3:187012067-187012089
Sequence TCCCCACTCACTGTTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967194127_967194135 16 Left 967194127 3:187012028-187012050 CCTCAATTTATTGCCCTTTCCCC 0: 1
1: 0
2: 1
3: 21
4: 307
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
967194132_967194135 -4 Left 967194132 3:187012048-187012070 CCCAGGACTCACATCTTCCTCCC 0: 1
1: 0
2: 4
3: 22
4: 376
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
967194133_967194135 -5 Left 967194133 3:187012049-187012071 CCAGGACTCACATCTTCCTCCCC 0: 1
1: 0
2: 3
3: 60
4: 835
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
967194129_967194135 3 Left 967194129 3:187012041-187012063 CCCTTTCCCCAGGACTCACATCT 0: 1
1: 0
2: 1
3: 31
4: 325
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
967194131_967194135 -3 Left 967194131 3:187012047-187012069 CCCCAGGACTCACATCTTCCTCC 0: 1
1: 0
2: 2
3: 38
4: 374
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
967194130_967194135 2 Left 967194130 3:187012042-187012064 CCTTTCCCCAGGACTCACATCTT 0: 1
1: 0
2: 4
3: 25
4: 327
Right 967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967194135 Original CRISPR TCCCCACTCACTGTTTGCCC AGG Intronic
900730511 1:4255855-4255877 TCCCCACTGAGTGTCTGCTCAGG + Intergenic
900928983 1:5724416-5724438 TTCCCACCTACTGTTGGCCCTGG + Intergenic
901457926 1:9374151-9374173 ACCCAACTCTCTGTTAGCCCTGG - Intergenic
901838803 1:11940829-11940851 TCCCAGCTCACTGTTAGGCCAGG - Intronic
901955656 1:12783393-12783415 GCCCCACGCACCGCTTGCCCAGG - Intergenic
902224951 1:14990933-14990955 TCCCCACCTGCTGTTTTCCCTGG - Intronic
902765787 1:18614126-18614148 TCTACACTGACTGTTTGCCCTGG + Intergenic
903839014 1:26225252-26225274 TGCCCACTCACTGGTTGGCATGG - Intergenic
904585805 1:31579890-31579912 CCCCCACTCCCTCTTTGCCTGGG + Intronic
904647933 1:31982277-31982299 ACCCCACACCCTCTTTGCCCTGG - Intergenic
905121898 1:35688819-35688841 TACCCACTCCATGTTGGCCCAGG - Intergenic
906532440 1:46531534-46531556 GCCCCAGTCACTGCTTGCCTAGG + Intergenic
907431173 1:54412532-54412554 TCCCCACTCCCTCCTTCCCCAGG - Intronic
909554688 1:76940606-76940628 TTACCACTCACTGTGTGGCCTGG - Intronic
912152524 1:106878080-106878102 CCTCCACTAACTGTTTGTCCAGG + Intergenic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
914808924 1:151012343-151012365 GCCCCACACACGGTTTGCCCAGG + Intronic
914917016 1:151825130-151825152 TGCCCACCAACTGTTGGCCCAGG + Intronic
918074743 1:181161484-181161506 TCCCCCATCACTGTTTTTCCTGG - Intergenic
919798616 1:201337120-201337142 TGCCCACTCCCTTTCTGCCCAGG + Intergenic
920822801 1:209397186-209397208 TTCCCACTCCCAGTTTGACCTGG + Intergenic
922504692 1:226119714-226119736 TCCACCCTCACTGTGTGCCAGGG + Intergenic
922787617 1:228290807-228290829 TCCTTACTCCCTGTCTGCCCTGG + Intronic
1062785473 10:261127-261149 GCCCCACTCACTGCTTTCCGGGG - Intergenic
1063417699 10:5887897-5887919 TACCTGCTCACTGTTTGCCCAGG - Exonic
1064916874 10:20468107-20468129 TCTCGACTCACTGCATGCCCTGG + Intergenic
1066380786 10:34899689-34899711 TCCCCAATCACTGTTTGTGTCGG - Intergenic
1069721445 10:70552102-70552124 TCCCTACTCAGTGTCCGCCCAGG - Intronic
1071349526 10:84726138-84726160 TCCCACCTCACAGTTTCCCCTGG + Intergenic
1071475913 10:86024817-86024839 TACCCACCCACTGTTTCCCTGGG - Intronic
1071833490 10:89395353-89395375 TCCCCACTCGCTGGTTGAGCAGG + Intronic
1072232505 10:93425379-93425401 CCCCCTCTCAGTGTTTTCCCAGG - Intronic
1073100754 10:101005390-101005412 TCCCCACTCAGTGTCTGCTCTGG - Intronic
1073190200 10:101645562-101645584 TCCCCGCTCAGGGATTGCCCAGG - Intronic
1074120361 10:110489564-110489586 AACCCACTTACTGTTTCCCCAGG + Intergenic
1074907371 10:117876980-117877002 TCTCCACCCACTGTTTGCTTAGG + Intergenic
1078442413 11:11378665-11378687 TGCCCACTTGCTGTTGGCCCTGG + Intronic
1079015851 11:16868048-16868070 TCCCCTCTAAGTCTTTGCCCAGG + Intronic
1082103108 11:48191008-48191030 TCTCCACACCCTGTTTGCCTGGG + Intergenic
1082558064 11:54586579-54586601 ACTCCAGTCACTGTTTGCCTGGG + Intergenic
1084576137 11:69989112-69989134 TCCCCACTCACTGTATGAGGTGG + Intergenic
1084907554 11:72359953-72359975 TCCACACACCCTGTTTACCCAGG + Intronic
1085353295 11:75814771-75814793 TCCGCCCTCACTGGTTGCCGTGG - Intergenic
1090213367 11:124938756-124938778 TCCCCACTCAAAGTGAGCCCCGG - Intergenic
1090805212 11:130198249-130198271 TCATCACTCACTGCTTCCCCAGG - Intronic
1091301307 11:134509871-134509893 TCCCAACTCACTGATGGGCCAGG + Intergenic
1092236112 12:6810804-6810826 GCCCTACTTGCTGTTTGCCCTGG - Intronic
1093084244 12:14848965-14848987 GCCCCACTCCCTATTTTCCCTGG + Intronic
1093716841 12:22392239-22392261 TCCCCACTCACTCATTGCCCCGG - Intronic
1095684434 12:45016495-45016517 TCCCCTCTCACGGTCTGCTCTGG - Exonic
1095802661 12:46284340-46284362 TTCCCAGACGCTGTTTGCCCAGG - Intergenic
1095854536 12:46845437-46845459 TCCTCACTCTCTTTTTCCCCAGG - Intergenic
1098887642 12:75976439-75976461 TCCCCTCTCTCTGATTTCCCTGG - Intergenic
1099373463 12:81866421-81866443 TCCTCACTCACTCCTTCCCCAGG + Intergenic
1099517144 12:83610983-83611005 TTACCACTCACTTTTTGGCCAGG + Intergenic
1100393753 12:94166666-94166688 TTCTCACTCACTGTGTGACCTGG - Intronic
1101259350 12:103013071-103013093 ACCACGGTCACTGTTTGCCCTGG - Intergenic
1103101376 12:118179265-118179287 TCCCCAGTCACTGCATGCCCAGG + Intronic
1103162138 12:118738280-118738302 TCCAACCTCACTGTTTGGCCTGG + Intergenic
1103237403 12:119384920-119384942 CCCCCACTCAATGTTTGGTCAGG - Intronic
1103737901 12:123072029-123072051 TCCCCATTCTCTGTCTGCACAGG + Intronic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1111777062 13:92677792-92677814 TCTACTCACACTGTTTGCCCAGG + Intronic
1112993572 13:105544602-105544624 GCCCCACTCACTGATGGCACTGG - Intergenic
1118760596 14:68878426-68878448 ACCCCACCCTCTGTCTGCCCTGG - Intronic
1119879800 14:78091279-78091301 TCACCACTGACTGTTCACCCTGG + Intergenic
1126697061 15:51335262-51335284 TGCCCACTCATTGTTTGACGTGG - Intronic
1127139565 15:55960900-55960922 TCCCCACTTCCTGTTGGCCCTGG + Intronic
1127703719 15:61527082-61527104 TCCCCACTCCCTGTTTCCTCTGG - Intergenic
1130139911 15:81216345-81216367 CCCTCACTCACTGCTTTCCCAGG + Intronic
1130153138 15:81326551-81326573 TGCCCACACAGTGTTTGCCAGGG + Intergenic
1130296216 15:82648232-82648254 TGCCGAGTCACTGTCTGCCCTGG + Intronic
1131654411 15:94440763-94440785 CACCCACTCTCTGATTGCCCTGG - Intronic
1134002670 16:10794855-10794877 TCCCCACTCACTCTCAGCCCAGG + Intronic
1134292500 16:12913668-12913690 TCTCCCCTCACTGTGTCCCCTGG + Intronic
1134815711 16:17204054-17204076 TCCTCACTCACTGTGTGACCTGG - Intronic
1135503339 16:23015742-23015764 TCCCCAGGCACTGTTTGCATGGG - Intergenic
1137272936 16:46914721-46914743 TCCCCGCTCATCGTCTGCCCTGG - Intronic
1137301274 16:47150248-47150270 TCCCCACATCCTGTTTGCTCTGG + Intergenic
1140037111 16:71379777-71379799 TTCTCACTGACTGTCTGCCCAGG - Intronic
1140211356 16:72973192-72973214 TGCCCCCTCACTGTCGGCCCTGG + Intronic
1140770992 16:78203905-78203927 TCCACACTCACTGTTAGCCCAGG - Intronic
1142685041 17:1572701-1572723 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1142687835 17:1587927-1587949 TCCCCAAGCACTGTTGGCCCTGG + Intronic
1143562300 17:7703295-7703317 TCCCCACTCTCTGTGGGCTCAGG - Exonic
1143686282 17:8518620-8518642 TACCCACTCACTTTCTGGCCAGG + Exonic
1144585612 17:16485892-16485914 TCCCCACTCCCTGTCTGCAGGGG - Intronic
1146618716 17:34378763-34378785 TCCCTGCTCACTGTTGTCCCTGG - Intergenic
1147602639 17:41755588-41755610 TCCCCAAGCACGGTGTGCCCTGG - Exonic
1148386016 17:47235699-47235721 CACCCACTCACTGAGTGCCCTGG - Intergenic
1151236071 17:72720510-72720532 TCCCCACTCCCTGCCTCCCCAGG - Intronic
1152132475 17:78485463-78485485 TCCCCTCTCACTGCAGGCCCAGG - Intronic
1152294039 17:79456400-79456422 TCCCCACCCACTGGATGCCAGGG + Intronic
1152309633 17:79541941-79541963 TCCCCACGCACTGGCTGCCGGGG + Intergenic
1153134667 18:1901516-1901538 TGCCCACTCAATGTTGGGCCTGG + Intergenic
1153707195 18:7757852-7757874 TCCCCACCCACTCTTCACCCTGG - Intronic
1153800346 18:8663005-8663027 TCCTCACTCGCTGTCTGGCCTGG + Intergenic
1153838730 18:8987451-8987473 CCCCCACTCTGTCTTTGCCCAGG + Intergenic
1154172704 18:12062897-12062919 TCCTCACTCACTGGGTGTCCTGG + Intergenic
1154172891 18:12063670-12063692 TCACCACTCACTCTCTGCCAAGG + Intergenic
1155302423 18:24442785-24442807 TCCCAACCCACTGCTTCCCCTGG + Intronic
1155355135 18:24944489-24944511 TCCCCTTTCACTGTTTTCCCAGG - Intergenic
1156295319 18:35784160-35784182 TCCCCACTCCCTGCCTGCCTTGG + Intergenic
1157233400 18:45940376-45940398 AGCCCATTCACTGTCTGCCCAGG - Intronic
1157997832 18:52580666-52580688 TCCCAACTCAGTGTTGGTCCAGG - Intronic
1160548334 18:79677171-79677193 TCCACACTCACTGTGTGAACAGG - Intergenic
1160574944 18:79848011-79848033 CCCTCACTCCCTGTTTGCCCAGG - Intergenic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
1160797621 19:953166-953188 TCCCCACTCCCAGGTGGCCCTGG + Intronic
1161321958 19:3645489-3645511 TTCCCCACCACTGTTTGCCCTGG + Intronic
1161508565 19:4657720-4657742 TCCCCACCCTCTTTGTGCCCCGG + Exonic
1161733009 19:5973646-5973668 GCCCCACTCAGAGTTGGCCCTGG - Intronic
1163635169 19:18434094-18434116 TCCCCACCCCATGTCTGCCCAGG + Intronic
1164784287 19:30917503-30917525 TCACCAGTCACTGTTAGCCGCGG - Intergenic
1166725570 19:45025338-45025360 TCCTCACACACTGGATGCCCAGG - Exonic
1168028458 19:53661078-53661100 TCCCCAATCACTTTTTAGCCGGG - Intergenic
925342380 2:3146442-3146464 ACCCCTCTCACTGTGTGGCCTGG + Intergenic
928111719 2:28515772-28515794 TCCCCACCCAATGCCTGCCCAGG - Intronic
929817730 2:45248898-45248920 ACCCCACCCACTCTGTGCCCAGG + Intergenic
931196436 2:60056309-60056331 TCCCAAGTCTCTGTTTACCCTGG - Intergenic
932458857 2:71869189-71869211 AATCCACTCACTGGTTGCCCTGG - Intergenic
932598336 2:73107925-73107947 TGCCCACCAACTGTCTGCCCAGG + Intronic
934771393 2:96909869-96909891 TCTCCACTCACAGGTTGGCCAGG - Intronic
934970025 2:98755671-98755693 TCCCTACACGCTGTTAGCCCAGG + Intergenic
935513540 2:104005802-104005824 CTCCCACTCACTCTGTGCCCAGG + Intergenic
936555723 2:113497508-113497530 TCCTCATTCACTGTCTGCACTGG - Intergenic
937302537 2:120852100-120852122 TCCCCACTCACTCTGGGCCTGGG - Intronic
938381110 2:130837091-130837113 TCCCCACCCACCGGGTGCCCAGG - Intronic
940104385 2:150081856-150081878 TACCCACTTACACTTTGCCCTGG - Intergenic
942641544 2:178066485-178066507 TCCCCTCCCACTGCCTGCCCAGG + Intronic
943656325 2:190512755-190512777 TTCCGAGTCACTGTTTGCCTCGG + Intronic
943929900 2:193836133-193836155 ACTCCAGACACTGTTTGCCCGGG + Intergenic
948502989 2:238408461-238408483 TCACTGCTCAATGTTTGCCCAGG + Intergenic
1168860419 20:1042458-1042480 TGCTCACTCACTGTGTGACCAGG + Intergenic
1169340501 20:4792820-4792842 GCCCCACCCACTGCTTGACCTGG - Intronic
1172811431 20:37650930-37650952 TACCCAATCTGTGTTTGCCCTGG - Intergenic
1174417695 20:50378358-50378380 TCACCATTCACTGTTTGCTTTGG - Intergenic
1174744527 20:53048409-53048431 TCCCCTCTCATCTTTTGCCCAGG + Intronic
1174747233 20:53075538-53075560 TCCCCTCTCTGTGTTTGCCAAGG - Intronic
1175640185 20:60622940-60622962 TCCTCAATCACTTTTTGCACAGG - Intergenic
1175895473 20:62333890-62333912 ACCCCACTCACAGTTGGCGCAGG + Exonic
1177540583 21:22488680-22488702 TCTCACCTCACTGTTTGCCAGGG + Intergenic
1179972446 21:44843797-44843819 GCCCTTCTCACTGTGTGCCCAGG - Intergenic
1184011975 22:41755872-41755894 TCCTCACCCTCTGCTTGCCCAGG + Intronic
1184339934 22:43880611-43880633 TCCCCGGTCACTGTGTACCCAGG - Exonic
1184520368 22:44990250-44990272 TCTCCACTGAGGGTTTGCCCAGG + Intronic
1184888835 22:47367297-47367319 TCAGCACTCACTCTTGGCCCGGG + Intergenic
949337122 3:2987006-2987028 TCCCAACTCACTGTTTACGGTGG - Intronic
950847808 3:16031742-16031764 AGCCCACTCACTGTTGGTCCTGG - Intergenic
951804257 3:26627288-26627310 TCCCTCCTCCCTGTTTACCCTGG - Intronic
952272179 3:31843865-31843887 TCCACAGTCACTGGTGGCCCTGG + Intronic
959586500 3:108030086-108030108 TACCCACTCCCTCTCTGCCCCGG - Intergenic
962279353 3:134038623-134038645 TCCCCTCTCTTTATTTGCCCAGG + Intronic
963318943 3:143791674-143791696 TCTCCACTAAATGTCTGCCCAGG + Intronic
965009028 3:163062692-163062714 CTCCCACTCACTGTTTCCCTGGG - Intergenic
967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG + Intronic
968420249 4:477943-477965 TCCCCACTTAGTTTCTGCCCAGG - Intronic
968570799 4:1339562-1339584 TCACCACTTCCTGTTGGCCCTGG + Exonic
968744812 4:2354090-2354112 TCCCCACCCACTCATGGCCCTGG - Intronic
969849193 4:9943215-9943237 TCCCCACTCACTCTGAGCCCTGG - Intronic
971040594 4:22747708-22747730 TCCCAACTCAGTGTCTGACCAGG + Intergenic
975712296 4:77172969-77172991 TGGCCACTCATTGTTTGACCTGG + Intronic
976230117 4:82833889-82833911 TCCCCCCTCACAGTTTCCCTGGG - Intronic
977536473 4:98261071-98261093 TCCCCATTCCCTGTTTTCTCCGG + Intergenic
979323442 4:119351107-119351129 TCCCCACCCACTCATTTCCCAGG - Intergenic
983241268 4:165235784-165235806 TCCCCACCCACTCATTTCCCAGG - Intronic
985518127 5:357497-357519 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518142 5:357559-357581 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518172 5:357683-357705 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518227 5:357931-357953 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518242 5:357993-358015 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518272 5:358117-358139 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518327 5:358365-358387 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518342 5:358427-358449 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518425 5:358799-358821 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518442 5:358861-358883 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518459 5:358923-358945 TCCCCAGTCGCTGACTGCCCGGG - Intronic
985518540 5:359295-359317 TCCCCAGTCGCTGACTGCCCGGG - Intronic
988289747 5:29270269-29270291 CCCCCACTCACAGTTTCCCTTGG - Intergenic
989516882 5:42354012-42354034 ACCCCACACCCTGTTTGCCTGGG - Intergenic
993486215 5:88489382-88489404 TTCTCACTCGCTGTTTGCTCTGG - Intergenic
996397805 5:123031326-123031348 CCCCCAAACACTGTATGCCCAGG + Intronic
997527126 5:134560608-134560630 TGCCCACCCACTGTTGGACCTGG - Intronic
1000549646 5:162644468-162644490 TGCGCATTCTCTGTTTGCCCAGG - Intergenic
1001118987 5:168963195-168963217 GTCTCACTCACTGTTTGGCCAGG + Intronic
1001543303 5:172554191-172554213 TACCAACTCACTGTGTGCCCTGG + Intergenic
1001771058 5:174296141-174296163 TCCCAACTCACAGTTGCCCCTGG + Intergenic
1002327271 5:178418006-178418028 GCCCCACTCACTGGCAGCCCAGG - Intronic
1003498110 6:6682249-6682271 TCCTCACCAACTGTCTGCCCAGG - Intergenic
1006849385 6:37086627-37086649 TCCCCATTCCCTGTTTCCTCCGG + Intergenic
1007858799 6:44885493-44885515 ACTCCAGTCACTGTTTGCCTGGG - Intronic
1019343486 7:519155-519177 TCCGCACTCACTGCTCGCGCCGG - Exonic
1020265903 7:6559899-6559921 TGCCCAGTCACTCCTTGCCCAGG + Intergenic
1022965478 7:35467676-35467698 TCCACACTCAATGCTTGCCATGG - Intergenic
1023270415 7:38456130-38456152 TCCCCTCTCCCTCTTTGGCCTGG - Intronic
1023569283 7:41555592-41555614 TCCCTACATACTGTTAGCCCAGG - Intergenic
1028170860 7:87593859-87593881 TCCCCACTCGCCTTTTGCCATGG + Intronic
1028279867 7:88910096-88910118 TACCTATTCACTTTTTGCCCTGG - Intronic
1029333165 7:99877051-99877073 TCTCCACTCTCTGTTTCCTCAGG - Exonic
1031123740 7:117749546-117749568 TCCCCACCAACTTTTTGTCCAGG + Intronic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1032267826 7:130381076-130381098 TCCCCACTCCCACTCTGCCCAGG + Exonic
1032554709 7:132819856-132819878 TCCGCACTCACGCTTTGGCCCGG - Intronic
1032736533 7:134697498-134697520 ACCTCACTCACTGTGTGCCCTGG - Intergenic
1035811820 8:2497966-2497988 TCCACACCCACAGTTTCCCCTGG - Intergenic
1037033379 8:14137020-14137042 ACCCCAGTCCCTGTTTGCCTTGG - Intronic
1039506147 8:38053885-38053907 TCCCCACTCCCTCTAGGCCCTGG - Intronic
1044212047 8:89561632-89561654 TCCCAACTCACTGGTTGAGCAGG + Intergenic
1047357642 8:124138887-124138909 TCCACACTCACTGTGTGCTCCGG + Intergenic
1048411249 8:134175836-134175858 TCCACACTCACTGTCTGTTCTGG + Intergenic
1048442361 8:134469376-134469398 TTCCTTCTCACTGTTTCCCCTGG + Intergenic
1048658281 8:136567911-136567933 TCCCCATTCACTCTTTCTCCTGG - Intergenic
1049146688 8:141005754-141005776 TCACCACTTACAGCTTGCCCAGG + Intergenic
1049845836 8:144800627-144800649 CCCCCACTCACTGTCTGTCCAGG - Intronic
1049878057 8:145040005-145040027 TCACCACTCACTGGGTGACCAGG - Intergenic
1049897308 9:119841-119863 TCCTCATTCACTGTCTGCACTGG + Intergenic
1051353335 9:16218500-16218522 ACCCCACTCCCTGTTTGCAGCGG - Intronic
1051389864 9:16552477-16552499 TCCCCACCCACAGTCGGCCCCGG + Intronic
1060309205 9:122444326-122444348 TTCCCTCTCTCTGTTAGCCCTGG + Intergenic
1060869302 9:127026912-127026934 TCCCATCCCACTTTTTGCCCGGG + Intronic
1185782317 X:2860054-2860076 CCCCCACTTACTGTGTGACCAGG - Exonic
1188238739 X:27759418-27759440 ACCCCAGACACTGTTTGCCTGGG - Intergenic
1189251039 X:39600831-39600853 ACCAGCCTCACTGTTTGCCCAGG - Intergenic
1189497827 X:41525416-41525438 TCCCCACTCACTCTTTTGCTTGG + Intronic
1190165206 X:48068034-48068056 TCCTCACTCGCTCGTTGCCCAGG - Intronic
1190873555 X:54444535-54444557 TCCCCACTCATTTTTTTCTCCGG - Exonic
1191886482 X:65893950-65893972 TCTCCAGGCACTGTTTGCCTGGG + Intergenic
1193496643 X:82220591-82220613 TTCTCACTCACTGTTTCCCTGGG + Intergenic
1194401233 X:93439915-93439937 TCCCCTCTCACTCCTTGACCTGG - Intergenic
1196197504 X:112851533-112851555 TCCCCACCCACCGATAGCCCAGG - Intergenic
1198583678 X:138096167-138096189 TCCCCACCCACTGGCAGCCCTGG + Intergenic
1199059150 X:143332747-143332769 TCCATACTCAGTGTTTACCCAGG + Intergenic
1199652787 X:149963464-149963486 TCTCCATTCACTGTATGCCAGGG - Intergenic
1200328031 X:155263528-155263550 TCTCCTCACACTGTTTTCCCAGG + Intronic
1201527179 Y:14949291-14949313 ACTCCACACACTGTTTGCCTGGG - Intergenic