ID: 967194284

View in Genome Browser
Species Human (GRCh38)
Location 3:187013080-187013102
Sequence ACGAAGACTTCAATTCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967194284 Original CRISPR ACGAAGACTTCAATTCATAA TGG Intronic
909211213 1:72827154-72827176 ACTAAGACTTCAGATGATAATGG - Intergenic
909404701 1:75274847-75274869 AAGAAGATTTAAATTCATAAAGG - Intronic
909728500 1:78865573-78865595 ACAAAGAATTCAATTTAAAATGG - Intergenic
912723352 1:112038398-112038420 TGGAAAACTTTAATTCATAAGGG - Intergenic
917005707 1:170414884-170414906 ACAAACATTTCTATTCATAAGGG + Intergenic
1068456600 10:57262918-57262940 TGGAAGACTTTTATTCATAAAGG + Intergenic
1070984701 10:80678698-80678720 CCGAAGACTTCAATATTTAAAGG + Intergenic
1071224872 10:83517199-83517221 AAGAACACTTCAATGAATAAAGG - Intergenic
1072274322 10:93807784-93807806 ACGCTGACTTCTGTTCATAATGG + Intergenic
1079573895 11:21979165-21979187 TCTAAGACTTCAAATAATAAGGG + Intergenic
1086196943 11:84152259-84152281 ATGAAGAGTTCAATTCAAAGAGG - Intronic
1092759824 12:11799659-11799681 ACGAGGACTTCATTTCGTAATGG - Intronic
1095549331 12:43415308-43415330 AGCAAAACTTCAAATCATAATGG - Intronic
1098202510 12:68070868-68070890 ACTGAGACTTCAAATCATAGAGG - Intergenic
1098692543 12:73506400-73506422 ATGAAGACTCCAAATCAGAAGGG - Intergenic
1099801717 12:87465436-87465458 AGGAAGACTTCACTGAATAAAGG + Intergenic
1100188830 12:92168252-92168274 AGGAAGACAAGAATTCATAAAGG + Intergenic
1100271485 12:93029447-93029469 AGAGAAACTTCAATTCATAATGG - Intergenic
1105819128 13:24063906-24063928 ACGAAGACCTCAGGTCATTAAGG - Intronic
1116516040 14:45806984-45807006 AATAAGAATTCAATTCTTAATGG + Intergenic
1117979221 14:61325458-61325480 ACAAAGACATTAATTCAAAATGG + Intronic
1120336219 14:83158864-83158886 ACCAAGACTTCAGGGCATAAGGG + Intergenic
1120357073 14:83448224-83448246 ATGAGGACATCTATTCATAAAGG + Intergenic
1122684852 14:103497542-103497564 ACGAAGAATTCTATTTAAAAGGG - Intronic
1127230960 15:56994345-56994367 AGGAAGATTTCAACTCACAATGG + Intronic
1128103797 15:65028575-65028597 ACGAAGGATTCAATACATGAGGG + Intronic
1144247392 17:13381051-13381073 ACTAAGTCTTCAGTTCATAATGG + Intergenic
1155834651 18:30565887-30565909 AGGAAGACTTCTATTCAAGATGG - Intergenic
1157438129 18:47688666-47688688 ACAAAGACTTCTATTCAGATTGG - Intergenic
1159940796 18:74406407-74406429 TCGAAGACTTCTATTCATGCTGG + Intergenic
926105661 2:10148588-10148610 GTGAAAACATCAATTCATAAAGG - Intronic
926585307 2:14679586-14679608 ATGTAGACTTGAATTCATAAGGG - Intergenic
929655122 2:43723354-43723376 ATGAAGACTCCAAGACATAAAGG + Intronic
933024594 2:77239689-77239711 ACGAAGAGTTCAATCCATCAAGG + Intronic
941515159 2:166464440-166464462 ATGAAAATTACAATTCATAAAGG - Intronic
942583413 2:177446578-177446600 ATGAAGAGTTCAGATCATAAAGG + Intronic
1170373066 20:15670443-15670465 AAGATGACTTTAATTCCTAAAGG - Intronic
1170457387 20:16546037-16546059 AAAAAGACTTCAAATCATAGTGG + Intronic
1172316628 20:33960439-33960461 ATGAAGAATTCAAATAATAAAGG - Intergenic
1177452819 21:21293613-21293635 AGGAAGATTTCAGTGCATAAAGG + Intronic
951469725 3:23043476-23043498 ACTAGGACTGCAATTTATAATGG - Intergenic
952153166 3:30614458-30614480 ACGAAGTCTTCATTTCCTATGGG + Intronic
953757789 3:45662628-45662650 AGGAAAATTTCAATTCATAATGG - Intronic
958816561 3:98923155-98923177 ATGAAGACATCAATCCATTAAGG + Intergenic
959484887 3:106915728-106915750 ATTAAGACTTCAATTTATTAAGG - Intergenic
959635345 3:108560973-108560995 CCCAAGACTTCATTTCATCATGG - Intronic
959969807 3:112396880-112396902 AGGAAGACTTGAAGTCATGAGGG - Intergenic
963369519 3:144380569-144380591 ACCATGACTTCAACTTATAAAGG - Intergenic
963970193 3:151421079-151421101 ACGTGGACTTCCACTCATAAAGG - Intronic
967194284 3:187013080-187013102 ACGAAGACTTCAATTCATAATGG + Intronic
969660473 4:8524645-8524667 ATGAAGAGTTCAAGCCATAAAGG + Intergenic
970993077 4:22235683-22235705 ACGAAAACTACTATTAATAATGG + Intergenic
971703519 4:30010799-30010821 ACGGAGACTGTAATTTATAAAGG - Intergenic
973087152 4:46079293-46079315 ACGAAGACGACAATTTAAAAAGG - Intronic
976893406 4:90078446-90078468 ACCAAGACTTGAATTCAGATAGG + Intergenic
977738632 4:100448779-100448801 AGGAAGACTTCAAGGCAGAAAGG - Intronic
982301673 4:153885074-153885096 AGGAAGGCTTCAATTTATCAAGG - Intergenic
982383617 4:154776503-154776525 ACTAAGACATAAATTCAGAATGG - Intergenic
987200721 5:15574910-15574932 ACAAAGATTTCAAGTCAGAATGG - Intronic
987234913 5:15932933-15932955 TCCAAGACTTCAATTTAGAAAGG - Intronic
995336265 5:111003076-111003098 ACAATGACATCAAATCATAAAGG + Intergenic
997299724 5:132793895-132793917 ACCAAGCCATCAATTCATAAGGG + Intronic
998306721 5:141084784-141084806 CCGAAGACTTCATTTACTAAAGG + Intergenic
998581255 5:143378300-143378322 GCGAAGACTGCAATCCATAAAGG + Intronic
1006487761 6:34358030-34358052 AAGTAGACTTCAATGCATATAGG - Intronic
1009434886 6:63606191-63606213 ACAAAGACCACAACTCATAAAGG - Intergenic
1009893885 6:69722688-69722710 ACGAATACTTAAAAACATAAAGG + Intronic
1011024177 6:82848283-82848305 ATGAAGAGGTCAATTCAGAAAGG + Intergenic
1013043029 6:106455466-106455488 AGAAACACTTTAATTCATAAAGG - Intergenic
1013877251 6:114847267-114847289 AAGAAGACTTCAATCCCTAAGGG + Intergenic
1015887776 6:137936964-137936986 TAGAAAACTTCAAATCATAAAGG - Intergenic
1024507447 7:50174238-50174260 GCGAAAACTTCAATTCACAGAGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1027544514 7:79510058-79510080 AAAAAGACTTCAAGTCATAATGG - Intergenic
1028225058 7:88240947-88240969 AGGAAGACTTCAATTTACCAGGG - Intergenic
1029222528 7:99001816-99001838 ATGAAGACTTCCATTCATGTGGG + Intronic
1033599648 7:142879728-142879750 ATGAAGACTTGAATTAATGAGGG - Intronic
1039283642 8:36014355-36014377 ACAAAGAATTTATTTCATAATGG + Intergenic
1040857510 8:51963374-51963396 ACTAAGATTTCAAATCATAGAGG - Intergenic
1043277373 8:78416153-78416175 AAGAATATTTTAATTCATAATGG - Intergenic
1046394193 8:113618639-113618661 TAGTAGAATTCAATTCATAAAGG - Intergenic
1046497444 8:115033756-115033778 AAGAAGGCTTAAATTCATCAGGG + Intergenic
1046655907 8:116893871-116893893 AAGAAGACATCAAATCAGAATGG + Intergenic
1049125714 8:140785784-140785806 ATGAAGAATTAAATTCAGAAAGG - Intronic
1052229395 9:26130289-26130311 ATGAAGACTTCAAGTCATACTGG + Intergenic
1052977679 9:34423530-34423552 AGGAAGACTTAAAATCATGAAGG + Intronic
1058565430 9:106279381-106279403 TTGAAGACAGCAATTCATAATGG + Intergenic
1185777413 X:2815479-2815501 TTGAAGACCCCAATTCATAATGG - Intronic
1188739644 X:33762786-33762808 GCGAAGCCTTCATATCATAAAGG - Intergenic
1194739446 X:97555370-97555392 AAGAAGACTGCATTTCTTAAAGG - Intronic
1198848445 X:140939017-140939039 TCGAGGATTTCAATTCTTAACGG + Intergenic
1199209037 X:145184646-145184668 CTGAGGACTTCCATTCATAAAGG - Intergenic