ID: 967194738

View in Genome Browser
Species Human (GRCh38)
Location 3:187016600-187016622
Sequence ACGTTTGGACATTTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967194738 Original CRISPR ACGTTTGGACATTTTTCTTT GGG (reversed) Intronic
900729236 1:4241734-4241756 TTGTTATGACATTTTTCTTTTGG + Intergenic
904017289 1:27432026-27432048 ACCATTGCTCATTTTTCTTTTGG + Intronic
905287650 1:36893350-36893372 TCCTTTGCACATTTTTCTATGGG - Intronic
906263826 1:44413071-44413093 AGGGGTGGACATGTTTCTTTAGG - Intronic
907077756 1:51593739-51593761 ACCATTGAACATTTGTCTTTAGG + Intronic
908014445 1:59815852-59815874 ATGAGTTGACATTTTTCTTTAGG + Intronic
910309157 1:85803578-85803600 AGGTTTGCACTTTTTTTTTTTGG + Intronic
910382340 1:86641738-86641760 ACATTTGGATATTTTACTTTGGG + Intergenic
912064755 1:105723379-105723401 AAGTTTGGATATTTTTATTTAGG - Intergenic
915868485 1:159531777-159531799 ACATTTAAACATTTATCTTTAGG - Intergenic
917204151 1:172552247-172552269 ACGTTTGGACCTTGTTCTGTGGG + Intronic
918747543 1:188224422-188224444 ACATTTGTCCATTTTTGTTTTGG + Intergenic
918780366 1:188692330-188692352 AAGTTTGGACATTGATCTATGGG - Intergenic
920386613 1:205574449-205574471 AAGTTTTGAGATTTTTGTTTTGG - Intronic
920434413 1:205938843-205938865 GGCTTTGGCCATTTTTCTTTGGG + Intronic
920672058 1:208011621-208011643 TCCTTTGCACATTTTTCTTTTGG + Intergenic
920981451 1:210840147-210840169 GCATTAGGGCATTTTTCTTTTGG + Intronic
921084020 1:211770426-211770448 TCTTTTGTACATTTTTCTTCTGG + Intronic
921995683 1:221415421-221415443 ACGTTTGGAGAATTTTCCTCAGG + Intergenic
923473771 1:234314227-234314249 ACGGTTGGACATTGACCTTTTGG - Intronic
924203369 1:241684273-241684295 ACCTTTGCTCATTTTTCTCTTGG - Intronic
1064279604 10:13939576-13939598 ACATATGGACATTTTTCTGGAGG - Intronic
1065148056 10:22792484-22792506 TCATTTGGACATTCTTTTTTGGG + Intergenic
1065444289 10:25781572-25781594 ACACATGGACAGTTTTCTTTTGG - Intergenic
1066604600 10:37149511-37149533 AGATTTGGAAAGTTTTCTTTTGG - Intronic
1066605405 10:37162508-37162530 AGATTTGGAAAGTTTTCTTTTGG - Intronic
1066606117 10:37173571-37173593 AGATTTGGAAAGTTTTCTTTTGG - Intronic
1066606901 10:37185372-37185394 AGATTTGGAAAGTTTTCTTTTGG - Intronic
1066607669 10:37197140-37197162 AGATTTGGAAAGTTTTCTTTTGG - Intronic
1068233676 10:54204097-54204119 ACATTTGGACATGTTTGTCTTGG + Intronic
1068257093 10:54525792-54525814 ATGTTTTTATATTTTTCTTTAGG - Intronic
1068398147 10:56490978-56491000 AAGATTAGACACTTTTCTTTAGG - Intergenic
1069116519 10:64513623-64513645 GCAATTGGTCATTTTTCTTTAGG + Intergenic
1069760028 10:70803313-70803335 ACCTTTGCTCATTTTTCTATTGG + Intergenic
1070350676 10:75589423-75589445 TCCTTTGCCCATTTTTCTTTGGG + Intronic
1071741842 10:88367827-88367849 ATCTTTGCCCATTTTTCTTTTGG + Intronic
1073262760 10:102203001-102203023 ACATTTGGAAATTTTTTGTTTGG + Intergenic
1074828552 10:117232150-117232172 ACATCTGGGCATTTTGCTTTTGG + Intergenic
1074842139 10:117365122-117365144 ATTTTTGGCCATTTTTTTTTTGG - Intronic
1076282216 10:129257606-129257628 ATCTGTGGACATTTTCCTTTTGG - Intergenic
1078696220 11:13634893-13634915 ACATCTGGCAATTTTTCTTTGGG + Intergenic
1079723810 11:23853824-23853846 ATTTTTGTACATTTTTTTTTTGG + Intergenic
1080017093 11:27519000-27519022 AAGTTTGGATTTTATTCTTTTGG + Intergenic
1080276479 11:30508731-30508753 ACGTTTGGCCCTTTGTCTGTGGG - Intronic
1082170751 11:49002132-49002154 ACATTTGGACATTTGTATGTGGG + Intergenic
1082775260 11:57239878-57239900 AGGATTGGGCGTTTTTCTTTGGG - Intergenic
1085141916 11:74152761-74152783 TCATTTGGATTTTTTTCTTTTGG - Intronic
1085911859 11:80836188-80836210 GAATTTGGACATTTTTCTGTAGG - Intergenic
1086695054 11:89834228-89834250 ACATTTGGACATTTGTATGTGGG - Intergenic
1086711096 11:90010256-90010278 ACATTTGGACATTTGTATGTGGG + Intergenic
1086999373 11:93398675-93398697 TCCTTTGCCCATTTTTCTTTTGG + Intronic
1087488856 11:98796059-98796081 ACCTCTGGAAAATTTTCTTTGGG - Intergenic
1087696598 11:101384604-101384626 ATATTTGGCTATTTTTCTTTTGG + Intergenic
1088985668 11:114905350-114905372 CCGTTTGTACATTTTTACTTTGG - Intergenic
1089234862 11:117015138-117015160 TCTTTTGCACATTTTTCTTTTGG - Intronic
1089824279 11:121259825-121259847 CCGTTTGTCCATTTTTCTTTTGG + Intergenic
1090108831 11:123883161-123883183 GTGTTTGGACTTTTTTGTTTAGG + Exonic
1090594171 11:128303248-128303270 ATTTTTGTACATTTTTTTTTTGG - Intergenic
1091568693 12:1665661-1665683 TCTTTTGCCCATTTTTCTTTGGG - Intergenic
1092485005 12:8895466-8895488 TCCTTTGCCCATTTTTCTTTTGG + Intergenic
1092913453 12:13168263-13168285 ATGTTTTGCCATTGTTCTTTGGG + Intergenic
1093046359 12:14450059-14450081 ATGTTTGAACAGTTGTCTTTAGG + Intronic
1093542729 12:20306077-20306099 CAGTTTGTACATTTTTATTTTGG - Intergenic
1094171716 12:27500158-27500180 AGGTCTAGACATTTTTCTTTGGG - Intronic
1095214970 12:39537676-39537698 ACTTATGTACATTTTTCATTAGG + Intergenic
1095392169 12:41720732-41720754 ACTCTTGCACATTTTTCTATTGG + Intergenic
1096600973 12:52729150-52729172 TCTTTTGAACATTTTTCTATCGG - Intergenic
1097237724 12:57551085-57551107 GGGTTTGGGCATTTTTCTTTAGG - Intronic
1097571960 12:61344955-61344977 AGGATTGTAAATTTTTCTTTGGG + Intergenic
1099701565 12:86089742-86089764 ACATTTTGCCATTTTGCTTTAGG + Intronic
1100071999 12:90733070-90733092 CTGTTTGTACATTTTGCTTTAGG + Intergenic
1100426691 12:94494191-94494213 ATTTCTGGAAATTTTTCTTTGGG + Intergenic
1100683427 12:96956875-96956897 ACTTTTGGAGATTATTCATTTGG - Intergenic
1101117421 12:101545623-101545645 TCATTTGTCCATTTTTCTTTTGG - Intergenic
1101277779 12:103221294-103221316 ACATTTACAGATTTTTCTTTGGG - Intergenic
1101990570 12:109480892-109480914 GTGTGTGTACATTTTTCTTTAGG + Intronic
1103211254 12:119168142-119168164 ACTCATGGAAATTTTTCTTTTGG + Intergenic
1105549309 13:21377983-21378005 AATTTTGGTCATTTTTCTCTGGG + Intronic
1105953053 13:25250490-25250512 ACCTTTGCTCATTTTTCTGTTGG - Intronic
1106083277 13:26518202-26518224 TCTTTTGTCCATTTTTCTTTTGG + Intergenic
1106347492 13:28893126-28893148 AAGTTTGGACTTTCTTCTTTAGG + Intronic
1106924243 13:34596735-34596757 ATATCTGGACATTTTTCTGTGGG - Intergenic
1106965834 13:35065956-35065978 TCGTGTGTACATTTTTTTTTTGG + Intronic
1107809775 13:44189170-44189192 ATGTTTGGACTTTTTTCTGTAGG - Intergenic
1109456843 13:62604026-62604048 AAGTTGGGACATTGATCTTTTGG + Intergenic
1109778419 13:67074969-67074991 AAGTTTAGACATTTTTTTTTAGG + Intronic
1110043309 13:70793999-70794021 ACATTAGGATATTTTGCTTTTGG + Intergenic
1110501807 13:76237178-76237200 ACATTTGCACATTTTTGTTTTGG - Intergenic
1112223689 13:97516264-97516286 ATGATTAGACATTTTTCTATGGG - Intergenic
1112447838 13:99481857-99481879 ACTTCTAGATATTTTTCTTTTGG + Intergenic
1113159668 13:107365492-107365514 ACGTTTTTCCATGTTTCTTTGGG - Intronic
1114592748 14:23882676-23882698 TCCTTTGTTCATTTTTCTTTTGG - Intergenic
1115275868 14:31607914-31607936 GCCTTTGGATAGTTTTCTTTTGG - Intronic
1115381434 14:32744636-32744658 ACTTATTGATATTTTTCTTTGGG + Intronic
1115416843 14:33145219-33145241 ATGTATGAAAATTTTTCTTTTGG + Intronic
1118553722 14:66988330-66988352 TCATTTGGAGATTTTTCTATTGG + Intronic
1118553864 14:66990448-66990470 TCATTTGGAGATTTTTCTGTTGG + Intronic
1119089528 14:71768053-71768075 ACCTTTGTCCATTTTTCTATTGG - Intergenic
1119904601 14:78290165-78290187 ACTTTTGAACATTTTTATTCTGG + Intronic
1121399747 14:93663389-93663411 ACATTTGCACATTGTTCTTAAGG - Intronic
1122051164 14:99061088-99061110 ATGATTGGGCAATTTTCTTTTGG - Intergenic
1124131400 15:26990643-26990665 TCATTTGGCCATTTTTGTTTTGG + Intronic
1125223737 15:37370382-37370404 AAGTTTGGACTTTATTCTTTGGG - Intergenic
1125420317 15:39498399-39498421 AATTATGGACATTTTTCTTTAGG - Intergenic
1125619849 15:41050797-41050819 AAGTTTCAACATTTTACTTTAGG - Intronic
1125859130 15:42981188-42981210 AAGTTTGAACTTTATTCTTTAGG - Intronic
1125863240 15:43017979-43018001 ACATTTCGACATTTCTTTTTTGG + Intronic
1125919056 15:43514233-43514255 AGGTTTGGACATTTTTATCATGG + Intronic
1126757586 15:51939672-51939694 ACGTTTTAAGATTTTTCCTTTGG - Intronic
1128902609 15:71438196-71438218 ATCTTTGCACATTTTTCTATTGG + Intronic
1128911275 15:71517787-71517809 AGGTTTGGACCTTTTTCCATGGG - Intronic
1129627490 15:77217549-77217571 ATGTTTTGACAGTTTTCATTAGG + Intronic
1131244096 15:90774951-90774973 ATGTTTGGACTTTATTCTTTTGG + Intronic
1131761807 15:95631554-95631576 CCGTTTGTCCATTTTTGTTTCGG + Intergenic
1131905867 15:97141901-97141923 AGGTTTGGACCCTCTTCTTTTGG - Intergenic
1131917509 15:97285878-97285900 ACTCTTGGCCATTTTTCTTTTGG - Intergenic
1133059241 16:3163818-3163840 ACTTTGTGACATTCTTCTTTTGG + Intergenic
1134145842 16:11760916-11760938 AACATTGAACATTTTTCTTTGGG + Intronic
1134419908 16:14076955-14076977 CCCTTTGCACATTTTTCTTTTGG + Intronic
1134591773 16:15460419-15460441 ACATTTAGACATTTTGCTCTGGG + Intronic
1134591872 16:15461212-15461234 ACATTTAGACATTTTGCTGTGGG + Intronic
1137656951 16:50168223-50168245 GCCTTTGTTCATTTTTCTTTTGG + Intronic
1137774453 16:51043742-51043764 TCATTTGGATATTTTTCTTGAGG - Intergenic
1140054917 16:71517095-71517117 AGGTTTGTACAATTTACTTTGGG + Intronic
1140800542 16:78484225-78484247 ACTTTTGTACCTTTCTCTTTAGG + Intronic
1143050573 17:4122230-4122252 AACTTTGTACATTTTCCTTTCGG - Intronic
1143947546 17:10606425-10606447 ACAATTGGACATGTATCTTTTGG - Intergenic
1145086109 17:19942264-19942286 TCCTTTGCTCATTTTTCTTTTGG - Intronic
1146581481 17:34041940-34041962 ACATATGGACATATTTCTGTTGG - Intronic
1147051097 17:37795708-37795730 GTGTTTGGAGATTTTTGTTTTGG + Intergenic
1147171932 17:38625953-38625975 ATTTTTGTATATTTTTCTTTTGG - Intergenic
1147889814 17:43709446-43709468 ACTGTTAGACATTTGTCTTTTGG + Intergenic
1148333703 17:46827389-46827411 GCTTTTGGACATTGTTGTTTTGG + Intronic
1149747061 17:59108641-59108663 AAGTTAGGAGATTTTTCTTGTGG - Intergenic
1152440986 17:80309557-80309579 ATGTTTGGACATGTATTTTTTGG - Intronic
1153154891 18:2137294-2137316 ACCTTTGGCCACTTTTCTATTGG - Intergenic
1154207706 18:12351950-12351972 ATATTTGGTCATTTGTCTTTAGG - Intronic
1155669553 18:28352239-28352261 ACGTTTGCATATTTTTTTTTAGG - Intergenic
1157089405 18:44618523-44618545 CCATTTGTCCATTTTTCTTTTGG - Intergenic
1158372110 18:56819094-56819116 ACTTTTTGAAATTTTTCTTTTGG + Intronic
1158930289 18:62318044-62318066 TCTTTTGTCCATTTTTCTTTTGG - Intergenic
1159365576 18:67462453-67462475 ATGATTTGACATTTTTCTCTAGG + Intergenic
1159463008 18:68743947-68743969 AGGTTAAGACATTTTTATTTTGG + Intronic
1159981993 18:74793708-74793730 GGGTTTGGACATTTTATTTTAGG + Intronic
924965832 2:75653-75675 ACATTTAAACATTTTCCTTTTGG + Intergenic
925071100 2:967040-967062 TTCTTTGTACATTTTTCTTTTGG - Intronic
925107470 2:1305071-1305093 ACAGTTGGTCATTTTTCTATGGG + Intronic
925367516 2:3320744-3320766 TCTTTTGGTCCTTTTTCTTTTGG - Intronic
926536366 2:14118281-14118303 ACCTTTGGATTTTTTTTTTTAGG + Intergenic
927334064 2:21900047-21900069 ATGTTTTGACATTTTACCTTGGG - Intergenic
928990570 2:37229368-37229390 TCCTTTGCACATTTTTCTTTTGG - Intronic
929016184 2:37498443-37498465 AGGTTTGAACATTTCTCTTTAGG + Intergenic
929709458 2:44251444-44251466 AATTTTGAACATTTTACTTTGGG + Intergenic
929821704 2:45279381-45279403 TCCTTTGTCCATTTTTCTTTTGG + Intergenic
931185589 2:59947937-59947959 AGTTTTGGATATTTTTCCTTTGG - Intergenic
933163197 2:79049105-79049127 CCATTTGCTCATTTTTCTTTTGG - Intergenic
933403187 2:81824763-81824785 ACTTTTTGAGATTTTACTTTAGG - Intergenic
933842546 2:86299062-86299084 CAGCTTGGACGTTTTTCTTTGGG - Intronic
935496847 2:103792656-103792678 ACCTTTGCCCATTTTTGTTTGGG + Intergenic
936806565 2:116339740-116339762 AAATTTGGACATTGTCCTTTGGG - Intergenic
937154555 2:119709909-119709931 ACATTTTGACATCTTTCTTTTGG - Intergenic
937570303 2:123349913-123349935 ACTTTTGGACATTTCTTTATTGG - Intergenic
938420655 2:131143714-131143736 TCCTTTGCACATTTTTCTGTTGG + Intronic
938655215 2:133424615-133424637 AGGTTTTTACATTTTTGTTTTGG - Intronic
938674680 2:133619600-133619622 AGGTTTGGACATTTATTCTTAGG - Intergenic
938888681 2:135680467-135680489 ACTTTTTAACATATTTCTTTCGG + Intronic
941634833 2:167925307-167925329 ACGTTTGGATTTTCTTATTTTGG + Intergenic
942684521 2:178517604-178517626 AAGTTTTGACATTTTTATGTGGG + Intergenic
943025858 2:182627607-182627629 ATGTCTGGAAATTTTTTTTTAGG - Intergenic
943244461 2:185428569-185428591 ATGTATGTACATTTTTCATTAGG + Intergenic
943604333 2:189958686-189958708 ACATTTGGAGGTTTTTTTTTCGG - Intronic
943655813 2:190507528-190507550 AAGTTTGAATATTTTTCTTATGG - Exonic
944476224 2:200109650-200109672 AGCATTGGAGATTTTTCTTTTGG - Intergenic
945523259 2:210855878-210855900 AGGTTTGAACATTTTTATTCAGG - Intergenic
945999929 2:216473831-216473853 ACTTTTGAGCATTTTTCTTTGGG + Intronic
946898927 2:224354206-224354228 ATGTTTGTACTTTTTTTTTTTGG - Intergenic
947481305 2:230502423-230502445 AAGTGTTGACAATTTTCTTTGGG - Intronic
948042822 2:234917189-234917211 ATGATTGGACATTTTTCTCTTGG - Intergenic
1169290146 20:4342712-4342734 AAGTTTGGACTTTATTCTGTGGG - Intergenic
1169292534 20:4364890-4364912 AGCTTTGGAGATTTCTCTTTAGG - Intergenic
1170274267 20:14566188-14566210 CCCTTTGCCCATTTTTCTTTTGG - Intronic
1171215999 20:23352703-23352725 GCTTTTGGACTTTTTTATTTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173078341 20:39842463-39842485 GAGTTTGGACATTATTCTGTAGG - Intergenic
1173374762 20:42473450-42473472 AGGTTTAGGCATTTGTCTTTGGG + Intronic
1173381912 20:42552763-42552785 TCCCTTGTACATTTTTCTTTGGG - Intronic
1174632695 20:51972061-51972083 ATCTTTGCTCATTTTTCTTTTGG - Intergenic
1174887002 20:54346858-54346880 ACGTTTTGCTATTTTTCTGTGGG - Intergenic
1177331812 21:19674249-19674271 ATTTTTGGGCATTTTTCTGTAGG - Intergenic
1177871991 21:26584937-26584959 ATCTTTGCCCATTTTTCTTTAGG + Intergenic
1178022132 21:28420894-28420916 ACTTTTGTACATTTTGCTTCAGG - Intergenic
1179717138 21:43294725-43294747 ACCTTTGTCCATTTTTCTATTGG + Intergenic
1183886112 22:40883734-40883756 ATGTTTTGAGATTTTTCTTCTGG + Intronic
1184193666 22:42911847-42911869 AGGTTTGGACACTTGTTTTTAGG - Intronic
1184315581 22:43685772-43685794 ACTTTTTGACCTATTTCTTTAGG + Intronic
1184819214 22:46896186-46896208 CCTTTTGCCCATTTTTCTTTTGG + Intronic
1185134117 22:49059052-49059074 ATTCTTGGACCTTTTTCTTTTGG + Intergenic
949209012 3:1476087-1476109 ACATTTGGACATTTTTCACGGGG + Intergenic
949243473 3:1897851-1897873 TCCTTTGCTCATTTTTCTTTTGG - Intergenic
949842789 3:8338256-8338278 ACTTCTGGACACTTTTATTTTGG - Intergenic
951135985 3:19105031-19105053 TCTTTTGTACATTTTTCTGTTGG - Intergenic
951246995 3:20352692-20352714 CCGTTTGTACATTTTTGCTTTGG + Intergenic
951295949 3:20934759-20934781 ACAGTTGGAGATTTGTCTTTAGG + Intergenic
953334563 3:42083275-42083297 TCCTTTGCCCATTTTTCTTTTGG + Intronic
954592068 3:51791449-51791471 TCTTTTGGCCATTTTTCTATTGG + Intergenic
955011933 3:55025979-55026001 CAGTTTGGACACTTTTCTGTAGG - Intronic
956822851 3:72969496-72969518 ATGTATTGTCATTTTTCTTTTGG + Intronic
957174768 3:76792603-76792625 AAGTTTGAAAATTTTTTTTTTGG + Intronic
960519194 3:118635951-118635973 ACATTTTGAATTTTTTCTTTGGG - Intergenic
960925038 3:122786317-122786339 ACCTTTGAACATTTTGCTTCTGG + Intronic
961234678 3:125355901-125355923 ACGTTTGGACCTCTTTATTGAGG - Intronic
962314695 3:134351819-134351841 ACAGTTGGACATGTTTTTTTGGG - Intergenic
962472651 3:135726163-135726185 ACATGTGCACATGTTTCTTTAGG + Intergenic
962478718 3:135780151-135780173 ATGTTTGAACATTTTTTTGTAGG + Intergenic
962590232 3:136882337-136882359 TCGTTTGCCCATTTTTCATTTGG + Intronic
962632434 3:137292436-137292458 ACCTTTGGGAATTTATCTTTAGG + Intergenic
964655889 3:159065751-159065773 ACCTTTGAACATTTATCTCTTGG + Intronic
965237648 3:166146712-166146734 ACATTTGAACATTTGTTTTTTGG + Intergenic
965244159 3:166245146-166245168 ACCTTTGGGCATTTATATTTGGG - Intergenic
965504605 3:169499241-169499263 AAGTTTGGACTTTTCTTTTTTGG - Intronic
965797333 3:172454156-172454178 ACTTTTGCCCATTTTTCTATTGG + Intergenic
966228917 3:177629096-177629118 ATGTTTGGAAATGTTTATTTTGG + Intergenic
966377974 3:179316600-179316622 ACCTGTGGGCATTTCTCTTTAGG + Intergenic
966583953 3:181600605-181600627 CCATTTGCACATTTTTGTTTTGG + Intergenic
967194738 3:187016600-187016622 ACGTTTGGACATTTTTCTTTGGG - Intronic
970693210 4:18643728-18643750 AGGCTTGGAGATTTTTATTTGGG - Intergenic
970736854 4:19181343-19181365 ACCTTTGGTCATTTTTTGTTGGG - Intergenic
970838172 4:20436111-20436133 ACATCTGGACTTTTGTCTTTTGG - Intronic
971165335 4:24176778-24176800 ACTTTTCGACCTTTCTCTTTAGG - Intergenic
971449051 4:26782799-26782821 ACTTTTGGATATATTGCTTTTGG - Intergenic
972274186 4:37541673-37541695 AGGTTTTGAGATTTTTCTTGAGG + Intronic
973587075 4:52404053-52404075 TCTTTTGTAAATTTTTCTTTAGG - Intergenic
974570817 4:63646332-63646354 AAGTTTAGACATTTTTCTTATGG - Intergenic
974788943 4:66660394-66660416 AGTTGTGGACATTATTCTTTTGG - Intergenic
975655180 4:76634131-76634153 ACGTATGTACACTTTCCTTTTGG + Intronic
975917748 4:79344988-79345010 CCGTTTGTCCATTTTTGTTTTGG + Intergenic
976609812 4:87018860-87018882 TCGAGAGGACATTTTTCTTTGGG + Intronic
977599587 4:98922012-98922034 ACGTGTGGGCATTTATTTTTAGG - Intronic
977806370 4:101303211-101303233 AATTTTGGCCATTTTACTTTAGG - Intronic
980689154 4:136270458-136270480 CAGTTTGGACAATTTTGTTTCGG - Intergenic
981313088 4:143315524-143315546 ATGCCTGGACATTTTTATTTAGG + Intergenic
981434561 4:144705128-144705150 AAGTTTGGATATTCTACTTTGGG + Intronic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
981947292 4:150362675-150362697 TAGTATGGACTTTTTTCTTTGGG - Intronic
983194181 4:164786775-164786797 ACATTTGGACACTTTACATTGGG + Intergenic
983405245 4:167321121-167321143 ATGTTTAGAAATTTTTCTTGGGG - Intergenic
983753563 4:171305278-171305300 AAGTCTGGCCACTTTTCTTTAGG - Intergenic
984294735 4:177839920-177839942 AAGTTTGGACATTTTTCATCTGG + Intronic
984435482 4:179705126-179705148 ACTTTTGCACATTTTCCTATTGG - Intergenic
984537569 4:180995835-180995857 AAGTTTGGACATTATTCCCTGGG + Intergenic
985374419 4:189319387-189319409 ACGTTTGTTCATTTTTGCTTTGG + Intergenic
986155747 5:5174479-5174501 GGGTTTTGATATTTTTCTTTAGG + Intronic
986408172 5:7447834-7447856 CCTTTTGGACACTTTTCTTCTGG - Intronic
986504498 5:8434595-8434617 GCGTTTGTACATTATTCTTATGG + Intergenic
987444161 5:17996036-17996058 ACATTTGGGCATTTTCATTTGGG + Intergenic
987525058 5:19037361-19037383 ACATTTGGATATTTTGCTTCTGG - Intergenic
988213669 5:28243422-28243444 TCTTTTGGAGATTTTTCCTTGGG + Intergenic
988879326 5:35483670-35483692 AAGTTGTGACAATTTTCTTTTGG - Intergenic
990023445 5:51157223-51157245 ACCACTGCACATTTTTCTTTAGG + Intergenic
990945495 5:61245143-61245165 ACTTTTGTCCATTTTTCCTTGGG + Intergenic
991293138 5:65052371-65052393 ACTTTTGATCATTTTTCTATTGG + Intergenic
991357597 5:65785404-65785426 TCCTTTGGACATTTTTATTGTGG - Intronic
991361175 5:65822198-65822220 ACCTTTGGAAAGTTTTCTTTGGG - Intronic
991903991 5:71489344-71489366 ACCTTTACAAATTTTTCTTTAGG + Intronic
992917013 5:81466155-81466177 ACTTTTGGTAAATTTTCTTTAGG + Intronic
992973906 5:82092105-82092127 GGGTTTGAACATTTTTCTTTTGG + Intronic
993355058 5:86895772-86895794 AGGTTTGAACATATTTATTTGGG - Intergenic
993693301 5:91029039-91029061 ACATTAGAACTTTTTTCTTTAGG + Intronic
995405160 5:111786455-111786477 ACTTTTGGACATCTTTCTGGAGG - Intronic
995407994 5:111823493-111823515 ACAACTGGACATTTTTCTTAGGG - Intronic
995763871 5:115594882-115594904 ACTTTAGGAGATTTTTTTTTAGG + Intronic
996616739 5:125451054-125451076 ACGTTAGGACTTTTTTCCTTAGG + Intergenic
998937438 5:147244681-147244703 AGGTTTGGAGACTTTTCTTGTGG - Intronic
1000530784 5:162417198-162417220 ATGTTTGAATAATTTTCTTTAGG + Intergenic
1001672933 5:173489479-173489501 AGGTTTGGAAATTTTTGGTTTGG + Intergenic
1002701102 5:181125546-181125568 ACTGTTGGACAATTCTCTTTTGG + Intergenic
1002809543 6:613956-613978 CCTTTTAGAAATTTTTCTTTTGG - Intronic
1003584286 6:7372610-7372632 AGGTTTGGAGAAGTTTCTTTTGG - Intronic
1003794530 6:9586006-9586028 ACAATTGGTGATTTTTCTTTGGG + Intergenic
1004568730 6:16824339-16824361 AAGTTTGGACATTTTTCTTTTGG + Intergenic
1005082776 6:21973632-21973654 ATGTTTAGACATTTTTCTTATGG + Intergenic
1007039991 6:38712918-38712940 TTGTTTTGACATTTTTATTTCGG + Intergenic
1007997756 6:46326604-46326626 ACAATTGGAAATTTTTCCTTTGG - Intronic
1008012459 6:46482939-46482961 ACATTTGGGCATTCTACTTTTGG + Intronic
1008289595 6:49697723-49697745 ACGTTTGGAAATGTTTTTTAAGG - Intronic
1008710956 6:54226609-54226631 CTGTTTGGTCATTTTTTTTTTGG - Intronic
1009832561 6:68956832-68956854 ACGTTATGAAATGTTTCTTTTGG - Intronic
1010645124 6:78378445-78378467 CCGTTTGTCCATTTTTGTTTTGG - Intergenic
1010922374 6:81699085-81699107 ACTTTTGCACATGTTTCTATTGG + Intronic
1011342932 6:86337845-86337867 AAATTTGGAGATTTTTGTTTTGG + Intergenic
1011994566 6:93568797-93568819 TCGTTTAGACACATTTCTTTTGG - Intergenic
1012327571 6:97941797-97941819 CTGTTTGGTCATTTTTCTTTGGG + Intergenic
1013092167 6:106909842-106909864 ATGTCTGTACATTTTTCTATTGG - Intergenic
1013161175 6:107546769-107546791 ATATTTGGTCATTTTTATTTAGG - Intronic
1013384643 6:109613934-109613956 ACATTCAAACATTTTTCTTTGGG + Intronic
1014326623 6:120004559-120004581 ACTTTTGCCTATTTTTCTTTTGG + Intergenic
1014632762 6:123806736-123806758 ACATTTGGGCATCTTTTTTTTGG + Intronic
1015793840 6:136990537-136990559 ACGATTGCACATTTGTATTTCGG + Intergenic
1016524041 6:144979635-144979657 CAGTTTGAACATTTTTCTTTTGG - Intergenic
1016703178 6:147076804-147076826 ACTTTTGCACATTTTTTTTTGGG - Intergenic
1018202410 6:161407820-161407842 ACCTTGTGACATTCTTCTTTCGG + Intronic
1019009317 6:168829265-168829287 ACTTCTGCCCATTTTTCTTTTGG + Intergenic
1019226343 6:170513169-170513191 ACTTTGGGACATGTTTCTATTGG + Intergenic
1020451571 7:8325661-8325683 AGGTTAGGGCATTATTCTTTTGG - Intergenic
1020981530 7:15075449-15075471 TCTTTTGTACATTCTTCTTTTGG - Intergenic
1021207421 7:17800737-17800759 ACCTTTTGTCATTTTTCTGTTGG - Intronic
1021342974 7:19488104-19488126 ACCTTTGCCCATTTTTATTTGGG + Intergenic
1021414877 7:20371987-20372009 AAGTTTGAACATTTTTCCTAAGG + Intronic
1021676635 7:23086686-23086708 ATTTTTGTTCATTTTTCTTTTGG - Intergenic
1022201483 7:28121699-28121721 ATGTTTGTACATTTCTCTGTGGG + Intronic
1023561314 7:41475878-41475900 ATCTTTGGACTTTCTTCTTTGGG - Intergenic
1026606727 7:71822590-71822612 ACCTGTGGACATTTTAGTTTTGG + Intronic
1027379873 7:77596169-77596191 TCGTTTAGACACTTTTTTTTAGG + Intronic
1027976801 7:85167817-85167839 ACATTGGGAAATGTTTCTTTTGG + Intronic
1028175121 7:87647481-87647503 ACATTGCTACATTTTTCTTTTGG + Intronic
1028216719 7:88141901-88141923 ACTTTTAGAAATTTTTCTTGAGG - Intronic
1028329495 7:89571973-89571995 ATGTTTGGATATTTTCCCTTTGG - Intergenic
1030472043 7:109976970-109976992 AAGTTTGCACATTTTTATCTTGG + Intergenic
1031101986 7:117492342-117492364 ATGTTTTGACCTTTTTTTTTTGG + Intronic
1031991604 7:128202469-128202491 AAGTGTGGACATTTCTCCTTGGG - Intergenic
1034334617 7:150313024-150313046 ACCTTGTGACATTCTTCTTTTGG + Intronic
1035611688 8:970101-970123 GCCGGTGGACATTTTTCTTTAGG - Intergenic
1036134832 8:6151253-6151275 ATTTATGGACATTTTTTTTTGGG - Intergenic
1036554960 8:9851170-9851192 CCCTTTGCTCATTTTTCTTTGGG - Intergenic
1036827032 8:11985564-11985586 ACGTTCGTCCATTTTTCTATTGG + Intergenic
1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG + Intergenic
1039181183 8:34868475-34868497 ACTTTTTGGCATTTTTCATTAGG - Intergenic
1039419517 8:37424303-37424325 AAGTCAGGACATTTTTGTTTGGG - Intergenic
1040757928 8:50803344-50803366 ACATTTGGACATTTGTCTATTGG - Intergenic
1041604008 8:59758831-59758853 AATTTTGGATTTTTTTCTTTAGG - Intergenic
1041864569 8:62555935-62555957 ACTTTTAGACATTTTCCATTAGG - Intronic
1043180284 8:77080253-77080275 ATGTTTGGACTTTATTCTATAGG - Intergenic
1043278466 8:78432084-78432106 AGGTTTTGATATTTTTCTTTAGG + Intergenic
1043591510 8:81838921-81838943 ATTTTTGTTCATTTTTCTTTTGG - Intronic
1043600889 8:81937066-81937088 ACATTTTGACAGTGTTCTTTAGG + Intergenic
1045274552 8:100691300-100691322 CCTTTTGGCCATTTTTCTATTGG - Intronic
1045311178 8:101004627-101004649 GTGTTTGTCCATTTTTCTTTTGG - Intergenic
1045384996 8:101663953-101663975 ACCTTTCGACCTTTTTCTTTAGG + Intronic
1045710544 8:104978396-104978418 GCACTTGCACATTTTTCTTTTGG + Intronic
1045899205 8:107255426-107255448 ACCTTTAGACATTTTCTTTTGGG + Intronic
1048072246 8:131033999-131034021 ATTTCTGTACATTTTTCTTTAGG - Intronic
1049240347 8:141534783-141534805 ACATTGGGACATATTTCATTAGG - Intergenic
1049526687 8:143130401-143130423 ACTTTTGAAAATGTTTCTTTCGG - Intergenic
1050202770 9:3164038-3164060 TCTTTTGTACATTTTTCTATTGG + Intergenic
1050900568 9:10942896-10942918 ACATTTGAATATTTTTCTTCTGG - Intergenic
1052080427 9:24199158-24199180 CCGTTTGTCCATTTTTCCTTTGG + Intergenic
1053283516 9:36836483-36836505 GCCCATGGACATTTTTCTTTAGG + Exonic
1055916762 9:81410101-81410123 ATGTTTTGTTATTTTTCTTTAGG - Intergenic
1056337509 9:85588523-85588545 AAGTTTGTATATTTTACTTTGGG + Intronic
1056440460 9:86615880-86615902 AAGTTTGGACTTTCTTTTTTTGG + Intergenic
1056991873 9:91421012-91421034 ACGTTTGGAGGTTTTTCTTAAGG + Intronic
1059666427 9:116450620-116450642 AAGTTTGGACATCTGACTTTTGG - Intronic
1060473713 9:123969951-123969973 ACATTGGCACATTTTTCTGTAGG - Intergenic
1060706826 9:125810585-125810607 ACTTGTGGACATTTTTATCTGGG + Intronic
1060784349 9:126438402-126438424 ACCTTTAGACTTTTTTTTTTTGG - Intronic
1186326718 X:8485828-8485850 ATGTTTCAACATTTTACTTTCGG - Intergenic
1186328101 X:8502038-8502060 ATGTTTGGATATATTTCTGTTGG - Intergenic
1186567442 X:10678709-10678731 ACCTTTGCCCGTTTTTCTTTTGG - Intronic
1186657412 X:11629884-11629906 GGCTTTGGAAATTTTTCTTTTGG - Intronic
1186788077 X:12971826-12971848 ATGTTGGCACATTTTTCATTGGG + Intergenic
1186862542 X:13687988-13688010 ACGTTTATACATATTTCCTTGGG + Intergenic
1187067953 X:15859112-15859134 ACGTATGAACATTTTCTTTTAGG + Intergenic
1187441507 X:19324846-19324868 TCCTTTGCTCATTTTTCTTTTGG - Intergenic
1188761546 X:34038042-34038064 AAGTATCGACAGTTTTCTTTGGG - Intergenic
1189692218 X:43628743-43628765 ACATTTGGAATTATTTCTTTAGG - Intergenic
1190035984 X:47024322-47024344 ACGTTTGAAAAATTTTTTTTTGG - Intronic
1190199296 X:48346360-48346382 ACGTGTGTGCATATTTCTTTAGG - Intergenic
1190666065 X:52696829-52696851 ACGTGTGTGCATATTTCTTTAGG - Intronic
1190673353 X:52761581-52761603 ACGTGTGTGCATATTTCTTTAGG + Intronic
1192197574 X:69038940-69038962 TCCTTTGCACATTTTTCTATTGG + Intergenic
1192478230 X:71462213-71462235 GCCTTTGCCCATTTTTCTTTTGG - Intronic
1193170930 X:78334528-78334550 TTGTTTGGTGATTTTTCTTTTGG + Intergenic
1193410612 X:81158109-81158131 ACATTTGCACATTTTTTTTCAGG - Intronic
1194047883 X:89032010-89032032 AAGTTTGGAAAATTTTTTTTAGG - Intergenic
1194971467 X:100348763-100348785 ATGTTTGAACATTTATCTTTGGG - Intronic
1195010316 X:100727281-100727303 TCCTTTGCACATTTATCTTTTGG - Intronic
1196006997 X:110847376-110847398 ACTTCTGGACATTTTTCTGGTGG + Intergenic
1196008812 X:110864574-110864596 ACTTTTGGACATTTTCCCGTAGG + Intergenic
1197229110 X:123984276-123984298 ATGTTTGAAAATTATTCTTTTGG - Intronic
1198467843 X:136919406-136919428 GCCTTTGCCCATTTTTCTTTTGG - Intergenic
1199577572 X:149327961-149327983 ACCTTTGAACATTTTTTGTTAGG - Intergenic
1201433916 Y:13936010-13936032 ATGTTTGGATATATTTCTGTTGG + Intergenic